Incidental Mutation 'R4886:Notch2'
ID375689
Institutional Source Beutler Lab
Gene Symbol Notch2
Ensembl Gene ENSMUSG00000027878
Gene Namenotch 2
SynonymsN2, Motch B
MMRRC Submission 042492-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4886 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location98013527-98150361 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98102419 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 554 (Y554F)
Ref Sequence ENSEMBL: ENSMUSP00000078741 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079812]
Predicted Effect probably damaging
Transcript: ENSMUST00000079812
AA Change: Y554F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078741
Gene: ENSMUSG00000027878
AA Change: Y554F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
EGF 27 63 5.79e-2 SMART
EGF 67 102 1.54e-6 SMART
EGF 108 143 6.25e-7 SMART
EGF 147 180 5.28e-5 SMART
EGF_CA 182 219 6.14e-15 SMART
EGF 224 258 5.08e-7 SMART
EGF_CA 260 296 1.95e-8 SMART
EGF_CA 298 336 3.91e-8 SMART
EGF_CA 338 374 7.69e-7 SMART
EGF 378 413 6.86e-4 SMART
EGF_CA 415 454 4.15e-12 SMART
EGF_CA 456 492 3.24e-14 SMART
EGF_CA 494 530 4.77e-12 SMART
EGF_CA 532 568 2.04e-11 SMART
EGF_CA 570 605 1.18e-7 SMART
EGF_CA 607 643 7.12e-11 SMART
EGF_CA 645 680 1.82e-8 SMART
EGF_CA 682 718 1.42e-10 SMART
EGF_CA 720 755 1.25e-6 SMART
EGF_CA 757 793 3.61e-12 SMART
EGF_CA 795 831 1.53e-10 SMART
EGF 836 871 1.34e-6 SMART
EGF_CA 873 909 6.05e-14 SMART
EGF_CA 911 947 9.54e-12 SMART
EGF_CA 949 985 1.39e-13 SMART
EGF_CA 987 1023 1.26e-11 SMART
EGF_CA 1025 1061 9.31e-15 SMART
EGF 1066 1099 1.39e-4 SMART
EGF 1104 1147 2.6e-4 SMART
EGF_CA 1149 1185 1.55e-11 SMART
EGF_CA 1187 1223 2.74e-12 SMART
EGF_CA 1225 1262 4.15e-12 SMART
EGF 1267 1302 1.43e-1 SMART
EGF 1307 1343 2.33e-6 SMART
EGF 1377 1412 9.85e-5 SMART
NL 1418 1456 8.55e-19 SMART
NL 1459 1497 2.27e-14 SMART
NL 1498 1535 1.16e-11 SMART
NOD 1539 1595 3.4e-28 SMART
NODP 1619 1679 1.66e-22 SMART
transmembrane domain 1680 1702 N/A INTRINSIC
ANK 1828 1872 2.18e2 SMART
ANK 1877 1906 3.36e-2 SMART
ANK 1910 1940 1.81e2 SMART
ANK 1944 1973 6.61e-1 SMART
ANK 1977 2006 5.24e-4 SMART
ANK 2010 2039 3.41e-3 SMART
low complexity region 2179 2193 N/A INTRINSIC
low complexity region 2232 2241 N/A INTRINSIC
DUF3454 2382 2447 4.62e-30 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198324
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Notch family. Members of this Type 1 transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple, different domain types. Notch family members play a role in a variety of developmental processes by controlling cell fate decisions. The Notch signaling network is an evolutionarily conserved intercellular signaling pathway which regulates interactions between physically adjacent cells. In Drosophilia, notch interaction with its cell-bound ligands (delta, serrate) establishes an intercellular signaling pathway that plays a key role in development. Homologues of the notch-ligands have also been identified in human, but precise interactions between these ligands and the human notch homologues remain to be determined. This protein is cleaved in the trans-Golgi network, and presented on the cell surface as a heterodimer. This protein functions as a receptor for membrane bound ligands, and may play a role in vascular, renal and hepatic development. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in embryonic or neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A T 2: 32,574,618 probably benign Het
Aagab G C 9: 63,636,456 A231P possibly damaging Het
Adgra3 C T 5: 49,999,195 D398N probably benign Het
Ap3b1 A T 13: 94,472,805 D616V possibly damaging Het
Apc2 T A 10: 80,314,213 H1700Q probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cdk6 G T 5: 3,344,444 K26N possibly damaging Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Col6a4 A G 9: 106,060,072 I1415T probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cpz T C 5: 35,506,704 N496D probably damaging Het
Cyp3a59 A G 5: 146,087,387 D61G probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Dbn1 A T 13: 55,477,542 probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhrs7c G A 11: 67,809,794 V56M probably damaging Het
Dnhd1 T A 7: 105,714,808 H4122Q probably benign Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Glt8d2 T C 10: 82,652,040 probably benign Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hcar2 G A 5: 123,865,197 T81M probably benign Het
Herpud2 G A 9: 25,124,989 P125L probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 T C 19: 43,384,764 Y142C probably damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Kcnk10 T C 12: 98,435,159 N405S possibly damaging Het
Klhl14 A T 18: 21,557,972 probably null Het
L3mbtl3 T A 10: 26,292,770 E587V unknown Het
Leap2 A T 11: 53,422,826 F40I probably damaging Het
Leng8 T A 7: 4,144,931 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Mansc1 T C 6: 134,610,662 H184R probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Med23 T C 10: 24,874,683 probably null Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Mrpl17 T C 7: 105,810,053 N112S probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp14 A T 7: 107,182,655 H353L probably benign Het
Nphp3 T C 9: 104,002,994 S72P probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olfr948 T C 9: 39,319,585 T10A probably benign Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pi4ka A G 16: 17,358,361 S405P probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prkar2a G A 9: 108,745,624 probably null Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Psg25 A T 7: 18,524,913 D279E probably benign Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Rnf168 C A 16: 32,299,196 T525K probably benign Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Sec63 T A 10: 42,789,393 Y106* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slc6a1 T A 6: 114,302,533 I91N possibly damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
St8sia1 G A 6: 142,914,134 L90F probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Thsd4 T A 9: 59,989,030 Y657F probably benign Het
Thsd7a A T 6: 12,327,660 C1404* probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Trim3 T A 7: 105,617,840 H444L probably damaging Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vmn2r19 G T 6: 123,309,841 K144N probably benign Het
Wdr41 C T 13: 95,015,174 Q281* probably null Het
Zfp938 T A 10: 82,226,123 Q221L probably benign Het
Other mutations in Notch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00675:Notch2 APN 3 98111675 missense possibly damaging 0.77
IGL01517:Notch2 APN 3 98138655 missense probably benign 0.16
IGL01630:Notch2 APN 3 98146618 missense possibly damaging 0.77
IGL01637:Notch2 APN 3 98146060 missense probably damaging 1.00
IGL01828:Notch2 APN 3 98072613 missense probably damaging 1.00
IGL01998:Notch2 APN 3 98143106 missense probably damaging 1.00
IGL02008:Notch2 APN 3 98147296 missense probably damaging 1.00
IGL02030:Notch2 APN 3 98099421 splice site probably null
IGL02155:Notch2 APN 3 98138490 missense probably damaging 0.98
IGL02268:Notch2 APN 3 98137397 missense probably damaging 1.00
IGL02301:Notch2 APN 3 98141554 missense probably benign 0.08
IGL02336:Notch2 APN 3 98138395 missense possibly damaging 0.73
IGL02340:Notch2 APN 3 98147336 nonsense probably null
IGL02536:Notch2 APN 3 98102407 missense probably benign 0.03
IGL02589:Notch2 APN 3 98104347 critical splice acceptor site probably null
IGL02633:Notch2 APN 3 98116697 splice site probably benign
IGL02691:Notch2 APN 3 98135607 nonsense probably null
IGL02832:Notch2 APN 3 98137373 missense probably benign 0.12
IGL02894:Notch2 APN 3 98102432 nonsense probably null
IGL02902:Notch2 APN 3 98111574 missense probably damaging 1.00
IGL02967:Notch2 APN 3 98146144 missense probably damaging 0.99
IGL03015:Notch2 APN 3 98072649 missense possibly damaging 0.83
PIT4378001:Notch2 UTSW 3 98142956 missense probably damaging 1.00
PIT4519001:Notch2 UTSW 3 98098108 missense probably damaging 1.00
PIT4581001:Notch2 UTSW 3 98104462 missense probably damaging 1.00
R0111:Notch2 UTSW 3 98138761 missense probably benign 0.00
R0129:Notch2 UTSW 3 98146620 missense probably benign 0.08
R0143:Notch2 UTSW 3 98146117 missense probably damaging 0.99
R0480:Notch2 UTSW 3 98146537 missense possibly damaging 0.88
R0523:Notch2 UTSW 3 98070970 missense probably benign 0.34
R0523:Notch2 UTSW 3 98111598 missense probably benign 0.00
R0531:Notch2 UTSW 3 98102451 splice site probably benign
R0537:Notch2 UTSW 3 98116741 missense possibly damaging 0.70
R0987:Notch2 UTSW 3 98134677 splice site probably null
R1485:Notch2 UTSW 3 98100257 missense probably benign 0.00
R1555:Notch2 UTSW 3 98131340 missense possibly damaging 0.93
R1625:Notch2 UTSW 3 98111575 missense probably damaging 1.00
R1699:Notch2 UTSW 3 98145127 missense probably damaging 1.00
R1765:Notch2 UTSW 3 98121926 missense probably damaging 1.00
R1794:Notch2 UTSW 3 98099547 missense possibly damaging 0.53
R1974:Notch2 UTSW 3 98072755 missense probably damaging 1.00
R2086:Notch2 UTSW 3 98102367 missense probably damaging 1.00
R2099:Notch2 UTSW 3 98115321 missense possibly damaging 0.79
R3778:Notch2 UTSW 3 98146623 missense probably damaging 1.00
R3924:Notch2 UTSW 3 98122034 nonsense probably null
R4018:Notch2 UTSW 3 98104565 missense probably damaging 1.00
R4151:Notch2 UTSW 3 98147071 missense possibly damaging 0.95
R4417:Notch2 UTSW 3 98131270 missense possibly damaging 0.95
R4510:Notch2 UTSW 3 98146321 missense probably benign 0.02
R4511:Notch2 UTSW 3 98146321 missense probably benign 0.02
R4636:Notch2 UTSW 3 98146104 missense probably benign 0.02
R4661:Notch2 UTSW 3 98135513 missense probably damaging 1.00
R4856:Notch2 UTSW 3 98102419 missense probably damaging 1.00
R4945:Notch2 UTSW 3 98111721 missense probably benign 0.01
R4970:Notch2 UTSW 3 98101636 critical splice donor site probably null
R4974:Notch2 UTSW 3 98139633 missense probably benign 0.39
R5082:Notch2 UTSW 3 98100374 missense probably damaging 1.00
R5112:Notch2 UTSW 3 98101636 critical splice donor site probably null
R5156:Notch2 UTSW 3 98124310 missense possibly damaging 0.53
R5433:Notch2 UTSW 3 98126134 missense probably damaging 1.00
R5539:Notch2 UTSW 3 98137582 missense probably damaging 0.99
R5813:Notch2 UTSW 3 98135428 missense probably benign
R5827:Notch2 UTSW 3 98072862 missense possibly damaging 0.64
R5908:Notch2 UTSW 3 98123923 intron probably benign
R6021:Notch2 UTSW 3 98121972 missense probably damaging 1.00
R6090:Notch2 UTSW 3 98135377 nonsense probably null
R6103:Notch2 UTSW 3 98135743 missense possibly damaging 0.94
R6111:Notch2 UTSW 3 98146293 missense probably benign 0.00
R6168:Notch2 UTSW 3 98145217 missense probably damaging 1.00
R6382:Notch2 UTSW 3 98141543 missense probably damaging 1.00
R6404:Notch2 UTSW 3 98081998 missense probably damaging 1.00
R6419:Notch2 UTSW 3 98100389 critical splice donor site probably null
R6454:Notch2 UTSW 3 98137406 missense possibly damaging 0.47
R6626:Notch2 UTSW 3 98101605 missense probably damaging 1.00
R6629:Notch2 UTSW 3 98120881 missense possibly damaging 0.65
R6706:Notch2 UTSW 3 98138430 missense possibly damaging 0.94
R6735:Notch2 UTSW 3 98134586 missense probably damaging 1.00
R6837:Notch2 UTSW 3 98070854 splice site probably null
R7021:Notch2 UTSW 3 98135446 missense probably benign
R7028:Notch2 UTSW 3 98102387 missense probably damaging 1.00
R7228:Notch2 UTSW 3 98137317 nonsense probably null
R7320:Notch2 UTSW 3 98131327 missense possibly damaging 0.94
R7361:Notch2 UTSW 3 98131402 missense probably benign 0.04
R7562:Notch2 UTSW 3 98113114 missense probably damaging 1.00
R7630:Notch2 UTSW 3 98137508 missense possibly damaging 0.65
R7637:Notch2 UTSW 3 98146623 missense probably damaging 1.00
R7748:Notch2 UTSW 3 98138484 missense possibly damaging 0.69
R7764:Notch2 UTSW 3 98142988 missense probably damaging 1.00
R7817:Notch2 UTSW 3 98107127 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCTGCCAGTGATTCAACCAC -3'
(R):5'- CTGTGTGGTGACAATGAGCC -3'

Sequencing Primer
(F):5'- CCACTGTTTCAGTAAAGGAAGATG -3'
(R):5'- CAGGAGGTCTGCAGCAGTAG -3'
Posted On2016-03-17