Incidental Mutation 'R4886:Cntln'
ID 375695
Institutional Source Beutler Lab
Gene Symbol Cntln
Ensembl Gene ENSMUSG00000038070
Gene Name centlein, centrosomal protein
Synonyms D530005L17Rik, B430108F07Rik
MMRRC Submission 042492-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.340) question?
Stock # R4886 (G1)
Quality Score 225
Status Not validated
Chromosome 4
Chromosomal Location 84802546-85050158 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 84889466 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 316 (E316D)
Ref Sequence ENSEMBL: ENSMUSP00000130491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047023] [ENSMUST00000169371]
AlphaFold A2AM05
Predicted Effect probably benign
Transcript: ENSMUST00000047023
AA Change: E316D

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000044138
Gene: ENSMUSG00000038070
AA Change: E316D

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.25e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.25e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 973 1114 N/A INTRINSIC
low complexity region 1206 1217 N/A INTRINSIC
Blast:HisKA 1270 1326 1e-24 BLAST
low complexity region 1327 1348 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169371
AA Change: E316D

PolyPhen 2 Score 0.351 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000130491
Gene: ENSMUSG00000038070
AA Change: E316D

DomainStartEndE-ValueType
low complexity region 4 24 N/A INTRINSIC
low complexity region 58 86 N/A INTRINSIC
coiled coil region 96 126 N/A INTRINSIC
internal_repeat_1 198 219 1.24e-5 PROSPERO
low complexity region 242 251 N/A INTRINSIC
internal_repeat_1 321 342 1.24e-5 PROSPERO
low complexity region 346 358 N/A INTRINSIC
coiled coil region 404 433 N/A INTRINSIC
low complexity region 434 446 N/A INTRINSIC
coiled coil region 458 481 N/A INTRINSIC
coiled coil region 516 584 N/A INTRINSIC
coiled coil region 606 648 N/A INTRINSIC
coiled coil region 674 780 N/A INTRINSIC
low complexity region 815 829 N/A INTRINSIC
coiled coil region 972 1113 N/A INTRINSIC
low complexity region 1205 1216 N/A INTRINSIC
Blast:HisKA 1269 1325 1e-24 BLAST
low complexity region 1326 1347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A T 2: 32,464,630 (GRCm39) probably benign Het
Aagab G C 9: 63,543,738 (GRCm39) A231P possibly damaging Het
Adgra3 C T 5: 50,156,537 (GRCm39) D398N probably benign Het
Ap3b1 A T 13: 94,609,313 (GRCm39) D616V possibly damaging Het
Apc2 T A 10: 80,150,047 (GRCm39) H1700Q probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atp2b4 T A 1: 133,634,518 (GRCm39) I1177L probably benign Het
Card6 T C 15: 5,134,623 (GRCm39) probably null Het
Cdk13 A G 13: 17,894,319 (GRCm39) S1103P probably benign Het
Cdk6 G T 5: 3,394,444 (GRCm39) K26N possibly damaging Het
Cfap221 T C 1: 119,861,934 (GRCm39) T614A probably damaging Het
Cfap221 T A 1: 119,912,488 (GRCm39) Y133F probably damaging Het
Clcc1 A G 3: 108,584,154 (GRCm39) T513A probably benign Het
Clec4g T A 8: 3,766,419 (GRCm39) probably benign Het
Col6a4 A G 9: 105,937,271 (GRCm39) I1415T probably benign Het
Cpne2 T A 8: 95,290,592 (GRCm39) D392E probably benign Het
Cpz T C 5: 35,664,048 (GRCm39) N496D probably damaging Het
Cyp3a59 A G 5: 146,024,197 (GRCm39) D61G probably damaging Het
Cyp4a29 T C 4: 115,110,078 (GRCm39) V440A probably benign Het
Dbn1 A T 13: 55,625,355 (GRCm39) probably benign Het
Ddx46 A G 13: 55,786,012 (GRCm39) D64G unknown Het
Dhrs7c G A 11: 67,700,620 (GRCm39) V56M probably damaging Het
Dnhd1 T A 7: 105,364,015 (GRCm39) H4122Q probably benign Het
Ecm2 A T 13: 49,676,263 (GRCm39) I327F possibly damaging Het
Elavl3 T C 9: 21,937,614 (GRCm39) K189E possibly damaging Het
Enam A T 5: 88,636,593 (GRCm39) R82* probably null Het
Fat3 T A 9: 15,932,626 (GRCm39) I1436F probably benign Het
Glt8d2 T C 10: 82,487,874 (GRCm39) probably benign Het
Grin2c T C 11: 115,151,616 (GRCm39) T115A probably damaging Het
H6pd C T 4: 150,067,235 (GRCm39) V384M possibly damaging Het
Hba-x A G 11: 32,227,008 (GRCm39) E39G probably benign Het
Hcar2 G A 5: 124,003,260 (GRCm39) T81M probably benign Het
Herpud2 G A 9: 25,036,285 (GRCm39) P125L probably benign Het
Hnrnpul2 C T 19: 8,807,191 (GRCm39) P618S probably benign Het
Hpse2 T C 19: 43,373,203 (GRCm39) Y142C probably damaging Het
Iqcm A T 8: 76,615,228 (GRCm39) R436S possibly damaging Het
Itih1 A G 14: 30,658,658 (GRCm39) probably null Het
Kcnk10 T C 12: 98,401,418 (GRCm39) N405S possibly damaging Het
Klhl14 A T 18: 21,691,029 (GRCm39) probably null Het
L3mbtl3 T A 10: 26,168,668 (GRCm39) E587V unknown Het
Leap2 A T 11: 53,313,653 (GRCm39) F40I probably damaging Het
Leng8 T A 7: 4,147,930 (GRCm39) probably null Het
Lrrc66 A G 5: 73,765,910 (GRCm39) F378L probably benign Het
Mansc1 T C 6: 134,587,625 (GRCm39) H184R probably benign Het
Map10 T A 8: 126,397,431 (GRCm39) Y275N probably damaging Het
Med23 T C 10: 24,750,581 (GRCm39) probably null Het
Mpp3 A G 11: 101,915,962 (GRCm39) Y55H probably benign Het
Mrpl17 T C 7: 105,459,260 (GRCm39) N112S probably benign Het
Nectin4 T C 1: 171,212,383 (GRCm39) V327A possibly damaging Het
Nlrp14 A T 7: 106,781,862 (GRCm39) H353L probably benign Het
Notch2 A T 3: 98,009,735 (GRCm39) Y554F probably damaging Het
Nphp3 T C 9: 103,880,193 (GRCm39) S72P probably damaging Het
Nrsn2 T C 2: 152,211,531 (GRCm39) K167E probably benign Het
Or14j8 A T 17: 38,262,962 (GRCm39) S318T probably benign Het
Or5b117 T C 19: 13,431,885 (GRCm39) probably null Het
Or8g30 T C 9: 39,230,881 (GRCm39) T10A probably benign Het
Or9i2 T A 19: 13,815,643 (GRCm39) E298V probably damaging Het
Osbpl9 T C 4: 108,925,564 (GRCm39) N485S probably benign Het
Pbk T A 14: 66,052,650 (GRCm39) H164Q probably damaging Het
Pfn2 G T 3: 57,754,874 (GRCm39) N10K probably damaging Het
Pi4ka A G 16: 17,176,225 (GRCm39) S405P Het
Pik3ca A G 3: 32,491,312 (GRCm39) D133G probably damaging Het
Pramel27 G T 4: 143,579,873 (GRCm39) R486L probably benign Het
Prkar2a G A 9: 108,622,823 (GRCm39) probably null Het
Prl6a1 A T 13: 27,502,983 (GRCm39) D193V probably damaging Het
Psg25 A T 7: 18,258,838 (GRCm39) D279E probably benign Het
Rad21 G T 15: 51,831,896 (GRCm39) P395Q probably damaging Het
Rnf168 C A 16: 32,118,014 (GRCm39) T525K probably benign Het
Rpn2 T C 2: 157,159,964 (GRCm39) probably null Het
Rreb1 G A 13: 38,115,034 (GRCm39) V798M possibly damaging Het
Scgb3a2 C T 18: 43,899,819 (GRCm39) P36S probably damaging Het
Scn3a T C 2: 65,291,376 (GRCm39) D1790G probably damaging Het
Sec24b A T 3: 129,777,619 (GRCm39) H1226Q probably benign Het
Sec63 T A 10: 42,665,389 (GRCm39) Y106* probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc12a3 G A 8: 95,078,438 (GRCm39) probably null Het
Slc6a1 T A 6: 114,279,494 (GRCm39) I91N possibly damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Spata1 C G 3: 146,175,529 (GRCm39) D326H probably damaging Het
St8sia1 G A 6: 142,859,860 (GRCm39) L90F probably damaging Het
Thsd4 T A 9: 59,896,313 (GRCm39) Y657F probably benign Het
Thsd7a A T 6: 12,327,659 (GRCm39) C1404* probably null Het
Tma16 A C 8: 66,934,129 (GRCm39) C75W probably damaging Het
Trgv4 T C 13: 19,369,236 (GRCm39) V29A probably benign Het
Trim3 T A 7: 105,267,047 (GRCm39) H444L probably damaging Het
Trmt10a A T 3: 137,854,146 (GRCm39) K75* probably null Het
Ttn T C 2: 76,561,644 (GRCm39) D28954G probably damaging Het
Uggt2 A G 14: 119,273,376 (GRCm39) probably null Het
Vars1 T A 17: 35,234,702 (GRCm39) V1177E probably benign Het
Vmn2r114 G T 17: 23,527,008 (GRCm39) A508E probably benign Het
Vmn2r19 G T 6: 123,286,800 (GRCm39) K144N probably benign Het
Wdr41 C T 13: 95,151,682 (GRCm39) Q281* probably null Het
Zfp938 T A 10: 82,061,957 (GRCm39) Q221L probably benign Het
Other mutations in Cntln
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00639:Cntln APN 4 84,924,671 (GRCm39) missense probably benign 0.25
IGL00743:Cntln APN 4 84,897,652 (GRCm39) missense probably benign 0.06
IGL01014:Cntln APN 4 84,968,145 (GRCm39) missense probably benign 0.25
IGL02217:Cntln APN 4 85,018,495 (GRCm39) missense probably damaging 1.00
IGL02323:Cntln APN 4 84,968,026 (GRCm39) missense probably benign 0.00
IGL02353:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02360:Cntln APN 4 84,968,087 (GRCm39) missense probably damaging 0.98
IGL02616:Cntln APN 4 85,033,689 (GRCm39) critical splice donor site probably null
PIT4696001:Cntln UTSW 4 84,892,237 (GRCm39) missense probably damaging 0.99
R0110:Cntln UTSW 4 85,014,994 (GRCm39) missense probably damaging 1.00
R0324:Cntln UTSW 4 85,010,932 (GRCm39) missense probably damaging 0.98
R0349:Cntln UTSW 4 84,914,722 (GRCm39) missense probably damaging 1.00
R0519:Cntln UTSW 4 84,923,290 (GRCm39) splice site probably benign
R0529:Cntln UTSW 4 84,986,062 (GRCm39) missense probably damaging 1.00
R0582:Cntln UTSW 4 84,802,978 (GRCm39) missense probably damaging 1.00
R1077:Cntln UTSW 4 84,914,716 (GRCm39) missense probably damaging 1.00
R1345:Cntln UTSW 4 84,892,228 (GRCm39) missense probably damaging 1.00
R1457:Cntln UTSW 4 85,015,076 (GRCm39) missense probably benign 0.33
R1571:Cntln UTSW 4 84,865,823 (GRCm39) nonsense probably null
R1622:Cntln UTSW 4 84,981,418 (GRCm39) missense probably damaging 1.00
R1681:Cntln UTSW 4 84,865,872 (GRCm39) missense probably damaging 1.00
R1777:Cntln UTSW 4 85,048,916 (GRCm39) missense probably benign 0.23
R1808:Cntln UTSW 4 85,015,000 (GRCm39) missense probably damaging 1.00
R1882:Cntln UTSW 4 85,019,072 (GRCm39) missense probably damaging 1.00
R2056:Cntln UTSW 4 84,967,911 (GRCm39) missense probably benign
R2965:Cntln UTSW 4 84,892,264 (GRCm39) critical splice donor site probably null
R2968:Cntln UTSW 4 84,875,504 (GRCm39) missense probably benign 0.27
R3104:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3106:Cntln UTSW 4 84,875,406 (GRCm39) missense possibly damaging 0.95
R3121:Cntln UTSW 4 84,923,289 (GRCm39) splice site probably benign
R3617:Cntln UTSW 4 84,923,214 (GRCm39) nonsense probably null
R4009:Cntln UTSW 4 84,981,452 (GRCm39) missense probably benign 0.45
R4036:Cntln UTSW 4 84,924,725 (GRCm39) missense probably damaging 1.00
R4548:Cntln UTSW 4 85,015,079 (GRCm39) missense probably benign 0.27
R4592:Cntln UTSW 4 84,889,419 (GRCm39) missense probably benign 0.00
R4666:Cntln UTSW 4 84,889,453 (GRCm39) missense probably benign 0.13
R4826:Cntln UTSW 4 84,923,281 (GRCm39) missense probably benign 0.03
R4836:Cntln UTSW 4 84,967,957 (GRCm39) nonsense probably null
R4856:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R4995:Cntln UTSW 4 84,968,120 (GRCm39) missense probably benign 0.00
R5090:Cntln UTSW 4 84,865,830 (GRCm39) missense probably damaging 0.98
R5202:Cntln UTSW 4 84,889,466 (GRCm39) missense probably benign 0.35
R5905:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R5953:Cntln UTSW 4 84,968,156 (GRCm39) missense possibly damaging 0.92
R6028:Cntln UTSW 4 84,889,410 (GRCm39) missense probably benign 0.03
R6298:Cntln UTSW 4 85,014,998 (GRCm39) missense probably damaging 1.00
R6351:Cntln UTSW 4 85,033,591 (GRCm39) missense probably damaging 0.99
R6371:Cntln UTSW 4 84,802,816 (GRCm39) missense probably damaging 0.98
R6481:Cntln UTSW 4 84,985,747 (GRCm39) missense probably benign 0.00
R6864:Cntln UTSW 4 85,015,029 (GRCm39) missense probably damaging 0.99
R6874:Cntln UTSW 4 84,985,996 (GRCm39) missense probably damaging 1.00
R6919:Cntln UTSW 4 85,033,605 (GRCm39) missense probably benign 0.04
R7071:Cntln UTSW 4 85,018,622 (GRCm39) missense probably damaging 1.00
R7113:Cntln UTSW 4 84,968,064 (GRCm39) missense probably damaging 0.98
R7152:Cntln UTSW 4 84,802,937 (GRCm39) missense possibly damaging 0.87
R7253:Cntln UTSW 4 85,036,710 (GRCm39) missense probably damaging 1.00
R7289:Cntln UTSW 4 84,964,540 (GRCm39) missense possibly damaging 0.80
R7440:Cntln UTSW 4 84,981,453 (GRCm39) missense possibly damaging 0.95
R7670:Cntln UTSW 4 84,897,577 (GRCm39) missense possibly damaging 0.66
R7707:Cntln UTSW 4 84,802,853 (GRCm39) missense probably damaging 1.00
R7895:Cntln UTSW 4 84,981,561 (GRCm39) missense possibly damaging 0.91
R8176:Cntln UTSW 4 84,806,926 (GRCm39) missense probably damaging 0.99
R8247:Cntln UTSW 4 85,019,017 (GRCm39) missense probably benign 0.39
R8264:Cntln UTSW 4 85,016,648 (GRCm39) missense probably damaging 1.00
R8293:Cntln UTSW 4 84,952,075 (GRCm39) missense probably damaging 1.00
R8536:Cntln UTSW 4 84,875,286 (GRCm39) missense probably damaging 1.00
R8844:Cntln UTSW 4 84,892,234 (GRCm39) missense probably damaging 1.00
R8924:Cntln UTSW 4 84,806,936 (GRCm39) missense probably damaging 1.00
R8955:Cntln UTSW 4 84,986,110 (GRCm39) missense possibly damaging 0.85
R8960:Cntln UTSW 4 85,018,961 (GRCm39) missense possibly damaging 0.59
R8979:Cntln UTSW 4 85,048,910 (GRCm39) missense probably damaging 1.00
R9255:Cntln UTSW 4 85,019,103 (GRCm39) missense possibly damaging 0.93
R9314:Cntln UTSW 4 84,924,719 (GRCm39) missense probably damaging 1.00
R9353:Cntln UTSW 4 84,802,597 (GRCm39) unclassified probably benign
R9361:Cntln UTSW 4 84,968,151 (GRCm39) missense probably benign 0.23
R9376:Cntln UTSW 4 84,875,258 (GRCm39) missense probably benign 0.24
R9382:Cntln UTSW 4 84,968,318 (GRCm39) missense probably benign 0.13
R9471:Cntln UTSW 4 84,968,019 (GRCm39) missense possibly damaging 0.62
R9478:Cntln UTSW 4 84,897,630 (GRCm39) missense probably benign 0.00
R9527:Cntln UTSW 4 84,892,120 (GRCm39) missense probably damaging 1.00
R9788:Cntln UTSW 4 84,968,093 (GRCm39) missense probably damaging 1.00
R9793:Cntln UTSW 4 84,985,798 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAGAGATGAATCCTGTACATTCCC -3'
(R):5'- AGTGCCGCTTTAGTCACAC -3'

Sequencing Primer
(F):5'- ATGAATCCTGTACATTCCCCCTGC -3'
(R):5'- ACTATTCCGGATTTTCACTGCATAAC -3'
Posted On 2016-03-17