Incidental Mutation 'R4886:Osbpl9'
ID375696
Institutional Source Beutler Lab
Gene Symbol Osbpl9
Ensembl Gene ENSMUSG00000028559
Gene Nameoxysterol binding protein-like 9
SynonymsORP-9, 2600011I06Rik
MMRRC Submission 042492-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4886 (G1)
Quality Score198
Status Not validated
Chromosome4
Chromosomal Location109061145-109202272 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 109068367 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 485 (N485S)
Ref Sequence ENSEMBL: ENSMUSP00000141991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030288] [ENSMUST00000084366] [ENSMUST00000159545] [ENSMUST00000160271] [ENSMUST00000160774] [ENSMUST00000161363] [ENSMUST00000162787] [ENSMUST00000194478]
Predicted Effect probably benign
Transcript: ENSMUST00000030288
AA Change: N475S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000030288
Gene: ENSMUSG00000028559
AA Change: N475S

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 253 274 N/A INTRINSIC
low complexity region 285 301 N/A INTRINSIC
low complexity region 349 362 N/A INTRINSIC
Pfam:Oxysterol_BP 377 729 7.3e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000084366
AA Change: N378S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000081396
Gene: ENSMUSG00000028559
AA Change: N378S

DomainStartEndE-ValueType
low complexity region 156 177 N/A INTRINSIC
low complexity region 188 204 N/A INTRINSIC
low complexity region 252 265 N/A INTRINSIC
Pfam:Oxysterol_BP 277 634 7.2e-82 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155434
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159198
Predicted Effect probably benign
Transcript: ENSMUST00000159545
SMART Domains Protein: ENSMUSP00000123856
Gene: ENSMUSG00000028559

DomainStartEndE-ValueType
Blast:PH 3 54 6e-33 BLAST
SCOP:d1pls__ 4 46 9e-8 SMART
PDB:2KCJ|A 4 55 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000160271
AA Change: N365S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124112
Gene: ENSMUSG00000028559
AA Change: N365S

DomainStartEndE-ValueType
low complexity region 143 164 N/A INTRINSIC
low complexity region 175 191 N/A INTRINSIC
low complexity region 239 252 N/A INTRINSIC
Pfam:Oxysterol_BP 264 621 4.7e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160774
AA Change: N458S

PolyPhen 2 Score 0.292 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000124742
Gene: ENSMUSG00000028559
AA Change: N458S

DomainStartEndE-ValueType
PH 3 84 6.46e-8 SMART
low complexity region 236 257 N/A INTRINSIC
low complexity region 268 284 N/A INTRINSIC
low complexity region 332 345 N/A INTRINSIC
Pfam:Oxysterol_BP 357 714 2.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161363
AA Change: N395S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000125714
Gene: ENSMUSG00000028559
AA Change: N395S

DomainStartEndE-ValueType
Blast:PH 13 34 3e-6 BLAST
low complexity region 173 194 N/A INTRINSIC
low complexity region 205 221 N/A INTRINSIC
low complexity region 269 282 N/A INTRINSIC
Pfam:Oxysterol_BP 294 651 2.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162787
AA Change: N462S

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000124370
Gene: ENSMUSG00000028559
AA Change: N462S

DomainStartEndE-ValueType
PH 3 101 8.5e-17 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 272 288 N/A INTRINSIC
low complexity region 336 349 N/A INTRINSIC
Pfam:Oxysterol_BP 361 718 2.8e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194478
AA Change: N485S

PolyPhen 2 Score 0.378 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000141991
Gene: ENSMUSG00000028559
AA Change: N485S

DomainStartEndE-ValueType
PH 3 101 3.7e-19 SMART
low complexity region 263 284 N/A INTRINSIC
low complexity region 295 311 N/A INTRINSIC
low complexity region 359 372 N/A INTRINSIC
Pfam:Oxysterol_BP 384 741 2e-79 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the oxysterol-binding protein (OSBP) family, a group of intracellular lipid receptors. Most members contain an N-terminal pleckstrin homology domain and a highly conserved C-terminal OSBP-like sterol-binding domain, although some members contain only the sterol-binding domain. This family member functions as a cholesterol transfer protein that regulates Golgi structure and function. Multiple transcript variants, most of which encode distinct isoforms, have been identified. Related pseudogenes have been identified on chromosomes 3, 11 and 12. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A T 2: 32,574,618 probably benign Het
Aagab G C 9: 63,636,456 A231P possibly damaging Het
Adgra3 C T 5: 49,999,195 D398N probably benign Het
Ap3b1 A T 13: 94,472,805 D616V possibly damaging Het
Apc2 T A 10: 80,314,213 H1700Q probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cdk6 G T 5: 3,344,444 K26N possibly damaging Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Col6a4 A G 9: 106,060,072 I1415T probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cpz T C 5: 35,506,704 N496D probably damaging Het
Cyp3a59 A G 5: 146,087,387 D61G probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Dbn1 A T 13: 55,477,542 probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhrs7c G A 11: 67,809,794 V56M probably damaging Het
Dnhd1 T A 7: 105,714,808 H4122Q probably benign Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Glt8d2 T C 10: 82,652,040 probably benign Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hcar2 G A 5: 123,865,197 T81M probably benign Het
Herpud2 G A 9: 25,124,989 P125L probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 T C 19: 43,384,764 Y142C probably damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Kcnk10 T C 12: 98,435,159 N405S possibly damaging Het
Klhl14 A T 18: 21,557,972 probably null Het
L3mbtl3 T A 10: 26,292,770 E587V unknown Het
Leap2 A T 11: 53,422,826 F40I probably damaging Het
Leng8 T A 7: 4,144,931 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Mansc1 T C 6: 134,610,662 H184R probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Med23 T C 10: 24,874,683 probably null Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Mrpl17 T C 7: 105,810,053 N112S probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp14 A T 7: 107,182,655 H353L probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nphp3 T C 9: 104,002,994 S72P probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olfr948 T C 9: 39,319,585 T10A probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pi4ka A G 16: 17,358,361 S405P probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prkar2a G A 9: 108,745,624 probably null Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Psg25 A T 7: 18,524,913 D279E probably benign Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Rnf168 C A 16: 32,299,196 T525K probably benign Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Sec63 T A 10: 42,789,393 Y106* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slc6a1 T A 6: 114,302,533 I91N possibly damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
St8sia1 G A 6: 142,914,134 L90F probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Thsd4 T A 9: 59,989,030 Y657F probably benign Het
Thsd7a A T 6: 12,327,660 C1404* probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Trim3 T A 7: 105,617,840 H444L probably damaging Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vmn2r19 G T 6: 123,309,841 K144N probably benign Het
Wdr41 C T 13: 95,015,174 Q281* probably null Het
Zfp938 T A 10: 82,226,123 Q221L probably benign Het
Other mutations in Osbpl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00722:Osbpl9 APN 4 109072010 missense probably damaging 1.00
IGL00793:Osbpl9 APN 4 109087431 missense probably damaging 0.99
IGL00809:Osbpl9 APN 4 109133763 missense probably damaging 1.00
IGL02071:Osbpl9 APN 4 109071979 missense probably damaging 1.00
IGL02547:Osbpl9 APN 4 109068483 nonsense probably null
IGL02822:Osbpl9 APN 4 109072921 missense probably damaging 1.00
IGL03074:Osbpl9 APN 4 109071961 missense probably damaging 1.00
IGL03193:Osbpl9 APN 4 109066966 missense possibly damaging 0.90
IGL03196:Osbpl9 APN 4 109072864 missense probably damaging 1.00
IGL03306:Osbpl9 APN 4 109172332 splice site probably benign
IGL03323:Osbpl9 APN 4 109062459 splice site probably benign
Oblong UTSW 4 109091679 missense possibly damaging 0.62
R0211:Osbpl9 UTSW 4 109073124 missense probably damaging 1.00
R0368:Osbpl9 UTSW 4 109066932 missense probably damaging 1.00
R0620:Osbpl9 UTSW 4 109083128 missense probably damaging 1.00
R1439:Osbpl9 UTSW 4 109101156 missense probably damaging 1.00
R1711:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R1757:Osbpl9 UTSW 4 109064583 missense probably damaging 1.00
R2237:Osbpl9 UTSW 4 109156657 missense probably damaging 1.00
R2295:Osbpl9 UTSW 4 109202134 missense probably damaging 0.99
R2418:Osbpl9 UTSW 4 109066218 missense probably damaging 1.00
R3111:Osbpl9 UTSW 4 109083093 missense probably benign 0.08
R4202:Osbpl9 UTSW 4 109172240 intron probably benign
R4672:Osbpl9 UTSW 4 109064609 missense possibly damaging 0.82
R4706:Osbpl9 UTSW 4 109156687 missense probably damaging 1.00
R4856:Osbpl9 UTSW 4 109068367 missense probably benign 0.38
R5035:Osbpl9 UTSW 4 109066167 missense probably damaging 0.99
R5309:Osbpl9 UTSW 4 109066155 missense probably damaging 1.00
R5400:Osbpl9 UTSW 4 109062300 nonsense probably null
R5719:Osbpl9 UTSW 4 109062566 nonsense probably null
R5810:Osbpl9 UTSW 4 109086374 missense probably benign 0.00
R6237:Osbpl9 UTSW 4 109156702 missense probably damaging 1.00
R6575:Osbpl9 UTSW 4 109072932 missense possibly damaging 0.89
R6648:Osbpl9 UTSW 4 109091679 missense possibly damaging 0.62
R6675:Osbpl9 UTSW 4 109133828 splice site probably null
R7130:Osbpl9 UTSW 4 109083099 missense probably benign
R7356:Osbpl9 UTSW 4 109068480 nonsense probably null
R7615:Osbpl9 UTSW 4 109086339 missense probably damaging 1.00
R7753:Osbpl9 UTSW 4 109133773 missense possibly damaging 0.86
R7772:Osbpl9 UTSW 4 109066187 missense probably damaging 0.99
R7788:Osbpl9 UTSW 4 109062494 missense probably benign 0.41
Z1177:Osbpl9 UTSW 4 109107880 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATCATGACACCAGAAGGCGC -3'
(R):5'- TGGAACATCACATTTGTCCTTGTC -3'

Sequencing Primer
(F):5'- CAGCTGGTAAAGTTGTCTGATGCC -3'
(R):5'- CTCTTCCAGCATTAGTGATCAGAAGG -3'
Posted On2016-03-17