Incidental Mutation 'R4886:Nlrp14'
ID375722
Institutional Source Beutler Lab
Gene Symbol Nlrp14
Ensembl Gene ENSMUSG00000016626
Gene NameNLR family, pyrin domain containing 14
Synonyms4921520L01Rik, GC-LRR, Nalp-iota, Nalp14
MMRRC Submission 042492-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R4886 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location107166990-107198102 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 107182655 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 353 (H353L)
Ref Sequence ENSEMBL: ENSMUSP00000081819 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084763] [ENSMUST00000142623]
Predicted Effect probably benign
Transcript: ENSMUST00000084763
AA Change: H353L

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000081819
Gene: ENSMUSG00000016626
AA Change: H353L

DomainStartEndE-ValueType
Pfam:NACHT 81 249 1.6e-38 PFAM
Blast:LRR 574 601 4e-6 BLAST
LRR 629 656 1.67e0 SMART
LRR 658 685 1.56e0 SMART
LRR 686 713 2.05e-2 SMART
LRR 715 742 7.9e-4 SMART
LRR 743 770 1.25e-1 SMART
LRR 772 799 4.68e-1 SMART
LRR 800 827 9.08e-4 SMART
LRR 829 856 1.59e1 SMART
LRR 857 884 7.15e-1 SMART
LRR 886 913 6.57e0 SMART
LRR 914 941 3.36e1 SMART
low complexity region 953 963 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142623
SMART Domains Protein: ENSMUSP00000145427
Gene: ENSMUSG00000016626

DomainStartEndE-ValueType
LRR 27 54 9.1e-5 SMART
LRR 56 83 3.4e-6 SMART
LRR 84 111 5.4e-4 SMART
LRR 113 140 2e-3 SMART
LRR 141 168 4e-6 SMART
LRR 170 197 6.7e-2 SMART
LRR 198 225 3.1e-3 SMART
LRR 227 254 2.8e-2 SMART
LRR 255 282 1.4e-1 SMART
low complexity region 294 304 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NALP protein family. Members of the NALP protein family typically contain a NACHT domain, a NACHT-associated domain (NAD), a C-terminal leucine-rich repeat (LRR) region, and an N-terminal pyrin domain (PYD). This protein may play a regulatory role in the innate immune system as similar family members belong to the signal-induced multiprotein complex, the inflammasome, that activates the pro-inflammatory caspases, caspase-1 and caspase-5. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A T 2: 32,574,618 probably benign Het
Aagab G C 9: 63,636,456 A231P possibly damaging Het
Adgra3 C T 5: 49,999,195 D398N probably benign Het
Ap3b1 A T 13: 94,472,805 D616V possibly damaging Het
Apc2 T A 10: 80,314,213 H1700Q probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cdk6 G T 5: 3,344,444 K26N possibly damaging Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Col6a4 A G 9: 106,060,072 I1415T probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cpz T C 5: 35,506,704 N496D probably damaging Het
Cyp3a59 A G 5: 146,087,387 D61G probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Dbn1 A T 13: 55,477,542 probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhrs7c G A 11: 67,809,794 V56M probably damaging Het
Dnhd1 T A 7: 105,714,808 H4122Q probably benign Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Glt8d2 T C 10: 82,652,040 probably benign Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hcar2 G A 5: 123,865,197 T81M probably benign Het
Herpud2 G A 9: 25,124,989 P125L probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 T C 19: 43,384,764 Y142C probably damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Kcnk10 T C 12: 98,435,159 N405S possibly damaging Het
Klhl14 A T 18: 21,557,972 probably null Het
L3mbtl3 T A 10: 26,292,770 E587V unknown Het
Leap2 A T 11: 53,422,826 F40I probably damaging Het
Leng8 T A 7: 4,144,931 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Mansc1 T C 6: 134,610,662 H184R probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Med23 T C 10: 24,874,683 probably null Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Mrpl17 T C 7: 105,810,053 N112S probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nphp3 T C 9: 104,002,994 S72P probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olfr948 T C 9: 39,319,585 T10A probably benign Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pi4ka A G 16: 17,358,361 S405P probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prkar2a G A 9: 108,745,624 probably null Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Psg25 A T 7: 18,524,913 D279E probably benign Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Rnf168 C A 16: 32,299,196 T525K probably benign Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Sec63 T A 10: 42,789,393 Y106* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slc6a1 T A 6: 114,302,533 I91N possibly damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
St8sia1 G A 6: 142,914,134 L90F probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Thsd4 T A 9: 59,989,030 Y657F probably benign Het
Thsd7a A T 6: 12,327,660 C1404* probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Trim3 T A 7: 105,617,840 H444L probably damaging Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vmn2r19 G T 6: 123,309,841 K144N probably benign Het
Wdr41 C T 13: 95,015,174 Q281* probably null Het
Zfp938 T A 10: 82,226,123 Q221L probably benign Het
Other mutations in Nlrp14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Nlrp14 APN 7 107192502 missense possibly damaging 0.91
IGL00337:Nlrp14 APN 7 107182101 missense possibly damaging 0.95
IGL00587:Nlrp14 APN 7 107181767 missense probably benign 0.10
IGL00654:Nlrp14 APN 7 107196144 missense probably damaging 1.00
IGL00712:Nlrp14 APN 7 107197241 missense probably damaging 1.00
IGL00765:Nlrp14 APN 7 107190139 missense possibly damaging 0.85
IGL01392:Nlrp14 APN 7 107197913 utr 3 prime probably benign
IGL02325:Nlrp14 APN 7 107182316 missense possibly damaging 0.95
IGL02572:Nlrp14 APN 7 107182722 nonsense probably null
IGL03180:Nlrp14 APN 7 107182626 missense probably benign 0.01
IGL03186:Nlrp14 APN 7 107186670 missense probably damaging 0.98
PIT4403001:Nlrp14 UTSW 7 107184892 missense possibly damaging 0.65
R0025:Nlrp14 UTSW 7 107181258 splice site probably benign
R0025:Nlrp14 UTSW 7 107181258 splice site probably benign
R0148:Nlrp14 UTSW 7 107182721 missense probably benign
R0720:Nlrp14 UTSW 7 107182013 missense probably benign 0.19
R0842:Nlrp14 UTSW 7 107183135 missense probably benign 0.08
R1367:Nlrp14 UTSW 7 107182811 missense probably benign 0.01
R1472:Nlrp14 UTSW 7 107182703 missense probably benign 0.33
R1483:Nlrp14 UTSW 7 107190122 missense possibly damaging 0.84
R1615:Nlrp14 UTSW 7 107196163 missense probably benign 0.37
R1991:Nlrp14 UTSW 7 107196200 missense probably benign 0.21
R2171:Nlrp14 UTSW 7 107182502 missense probably damaging 0.99
R2287:Nlrp14 UTSW 7 107182662 missense probably damaging 1.00
R2394:Nlrp14 UTSW 7 107197824 missense probably benign 0.13
R3151:Nlrp14 UTSW 7 107182552 missense probably benign 0.32
R3732:Nlrp14 UTSW 7 107182367 missense probably benign 0.00
R3793:Nlrp14 UTSW 7 107182274 missense probably benign 0.00
R4368:Nlrp14 UTSW 7 107197805 missense probably benign 0.01
R4652:Nlrp14 UTSW 7 107181817 missense probably benign 0.05
R4772:Nlrp14 UTSW 7 107181186 missense probably benign 0.07
R4896:Nlrp14 UTSW 7 107197179 frame shift probably null
R4910:Nlrp14 UTSW 7 107186583 missense possibly damaging 0.93
R5925:Nlrp14 UTSW 7 107186653 missense probably benign 0.35
R5997:Nlrp14 UTSW 7 107182496 missense probably benign 0.11
R6192:Nlrp14 UTSW 7 107182439 missense probably benign 0.00
R6230:Nlrp14 UTSW 7 107181817 missense probably benign 0.05
R6799:Nlrp14 UTSW 7 107196139 missense probably benign 0.37
R7116:Nlrp14 UTSW 7 107183048 missense possibly damaging 0.86
R7131:Nlrp14 UTSW 7 107184814 missense possibly damaging 0.47
R7387:Nlrp14 UTSW 7 107183107 missense probably damaging 0.98
R7472:Nlrp14 UTSW 7 107190044 missense probably benign 0.09
R7565:Nlrp14 UTSW 7 107181887 nonsense probably null
R7810:Nlrp14 UTSW 7 107192575 nonsense probably null
X0019:Nlrp14 UTSW 7 107182927 missense probably benign 0.11
X0050:Nlrp14 UTSW 7 107196163 missense probably benign 0.37
Z1088:Nlrp14 UTSW 7 107186622 missense probably damaging 1.00
Z1176:Nlrp14 UTSW 7 107182714 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAACCAGCACGGCTCTGTTC -3'
(R):5'- CTGTTCCAAATGAGGGTCATGAATG -3'

Sequencing Primer
(F):5'- AGCACGGCTCTGTTCACATAC -3'
(R):5'- TACAAGTTTTCAAAAGGTTCAGAGGG -3'
Posted On2016-03-17