Incidental Mutation 'R4886:Nphp3'
ID375735
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Namenephronophthisis 3 (adolescent)
Synonyms3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
MMRRC Submission 042492-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4886 (G1)
Quality Score139
Status Not validated
Chromosome9
Chromosomal Location104002544-104043818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104002994 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 72 (S72P)
Ref Sequence ENSEMBL: ENSMUSP00000035167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]
Predicted Effect probably damaging
Transcript: ENSMUST00000035167
AA Change: S72P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: S72P

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191919
Predicted Effect probably benign
Transcript: ENSMUST00000193439
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193642
Predicted Effect probably benign
Transcript: ENSMUST00000194774
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216588
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A T 2: 32,574,618 probably benign Het
Aagab G C 9: 63,636,456 A231P possibly damaging Het
Adgra3 C T 5: 49,999,195 D398N probably benign Het
Ap3b1 A T 13: 94,472,805 D616V possibly damaging Het
Apc2 T A 10: 80,314,213 H1700Q probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cdk6 G T 5: 3,344,444 K26N possibly damaging Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Col6a4 A G 9: 106,060,072 I1415T probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cpz T C 5: 35,506,704 N496D probably damaging Het
Cyp3a59 A G 5: 146,087,387 D61G probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Dbn1 A T 13: 55,477,542 probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhrs7c G A 11: 67,809,794 V56M probably damaging Het
Dnhd1 T A 7: 105,714,808 H4122Q probably benign Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Glt8d2 T C 10: 82,652,040 probably benign Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hcar2 G A 5: 123,865,197 T81M probably benign Het
Herpud2 G A 9: 25,124,989 P125L probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 T C 19: 43,384,764 Y142C probably damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Kcnk10 T C 12: 98,435,159 N405S possibly damaging Het
Klhl14 A T 18: 21,557,972 probably null Het
L3mbtl3 T A 10: 26,292,770 E587V unknown Het
Leap2 A T 11: 53,422,826 F40I probably damaging Het
Leng8 T A 7: 4,144,931 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Mansc1 T C 6: 134,610,662 H184R probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Med23 T C 10: 24,874,683 probably null Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Mrpl17 T C 7: 105,810,053 N112S probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp14 A T 7: 107,182,655 H353L probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olfr948 T C 9: 39,319,585 T10A probably benign Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pi4ka A G 16: 17,358,361 S405P probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prkar2a G A 9: 108,745,624 probably null Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Psg25 A T 7: 18,524,913 D279E probably benign Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Rnf168 C A 16: 32,299,196 T525K probably benign Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Sec63 T A 10: 42,789,393 Y106* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slc6a1 T A 6: 114,302,533 I91N possibly damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
St8sia1 G A 6: 142,914,134 L90F probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Thsd4 T A 9: 59,989,030 Y657F probably benign Het
Thsd7a A T 6: 12,327,660 C1404* probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Trim3 T A 7: 105,617,840 H444L probably damaging Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vmn2r19 G T 6: 123,309,841 K144N probably benign Het
Wdr41 C T 13: 95,015,174 Q281* probably null Het
Zfp938 T A 10: 82,226,123 Q221L probably benign Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6298:Nphp3 UTSW 9 104015441 missense probably damaging 1.00
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7665:Nphp3 UTSW 9 104005393 intron probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
R8039:Nphp3 UTSW 9 104031963 missense probably benign
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGGTGATCGAGGACACGTAC -3'
(R):5'- AAAACAACTTGGTTTGTAGCTGGG -3'

Sequencing Primer
(F):5'- GACACGTACGGGGCAGG -3'
(R):5'- GGGTCTCAGTTTCCTCAGAGC -3'
Posted On2016-03-17