Incidental Mutation 'R4886:Apc2'
ID375741
Institutional Source Beutler Lab
Gene Symbol Apc2
Ensembl Gene ENSMUSG00000020135
Gene Nameadenomatosis polyposis coli 2
SynonymsAPCL
MMRRC Submission 042492-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.370) question?
Stock #R4886 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location80295977-80318263 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 80314213 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 1700 (H1700Q)
Ref Sequence ENSEMBL: ENSMUSP00000100996 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020341] [ENSMUST00000020349] [ENSMUST00000105359]
Predicted Effect probably benign
Transcript: ENSMUST00000020341
SMART Domains Protein: ENSMUSP00000020341
Gene: ENSMUSG00000020133

DomainStartEndE-ValueType
Pfam:UPF0449 6 103 7.5e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000020349
AA Change: H1671Q

PolyPhen 2 Score 0.768 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000020349
Gene: ENSMUSG00000020135
AA Change: H1671Q

DomainStartEndE-ValueType
PDB:1DEB|B 4 57 9e-17 PDB
Pfam:Suppressor_APC 123 205 1.3e-28 PFAM
coiled coil region 214 236 N/A INTRINSIC
low complexity region 242 261 N/A INTRINSIC
ARM 300 355 2.95e0 SMART
ARM 417 468 2.22e-2 SMART
ARM 470 511 3.22e0 SMART
ARM 513 555 3.56e-1 SMART
ARM 557 602 2.1e1 SMART
ARM 607 647 1.82e-7 SMART
Blast:ARM 649 689 6e-18 BLAST
low complexity region 772 792 N/A INTRINSIC
low complexity region 817 844 N/A INTRINSIC
low complexity region 859 870 N/A INTRINSIC
low complexity region 971 980 N/A INTRINSIC
low complexity region 1057 1069 N/A INTRINSIC
low complexity region 1087 1103 N/A INTRINSIC
Pfam:APC_crr 1134 1159 4.4e-9 PFAM
low complexity region 1197 1208 N/A INTRINSIC
Pfam:APC_crr 1244 1269 4.1e-8 PFAM
Pfam:SAMP 1323 1343 2.1e-10 PFAM
Pfam:APC_crr 1369 1394 5.8e-8 PFAM
low complexity region 1500 1516 N/A INTRINSIC
Pfam:APC_crr 1540 1565 5.7e-8 PFAM
Pfam:SAMP 1594 1613 8.8e-11 PFAM
low complexity region 1673 1699 N/A INTRINSIC
Pfam:APC_basic 1757 2093 1.1e-142 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105359
AA Change: H1700Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000100996
Gene: ENSMUSG00000020135
AA Change: H1700Q

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:APC_N_CC 30 81 2.7e-34 PFAM
Pfam:Suppressor_APC 148 228 1.4e-27 PFAM
coiled coil region 238 260 N/A INTRINSIC
low complexity region 266 285 N/A INTRINSIC
ARM 324 379 2.95e0 SMART
ARM 446 497 2.22e-2 SMART
ARM 499 540 3.22e0 SMART
ARM 542 584 3.56e-1 SMART
ARM 586 631 2.1e1 SMART
ARM 636 676 1.82e-7 SMART
Blast:ARM 678 718 6e-18 BLAST
Pfam:Arm_APC_u3 719 977 1.1e-26 PFAM
low complexity region 1000 1009 N/A INTRINSIC
low complexity region 1086 1098 N/A INTRINSIC
low complexity region 1116 1132 N/A INTRINSIC
Pfam:APC_crr 1164 1187 9.3e-8 PFAM
low complexity region 1226 1237 N/A INTRINSIC
Pfam:APC_crr 1274 1297 7.9e-10 PFAM
Pfam:APC_crr 1399 1423 1.3e-9 PFAM
low complexity region 1529 1545 N/A INTRINSIC
low complexity region 1585 1603 N/A INTRINSIC
Pfam:SAMP 1624 1642 1.3e-11 PFAM
low complexity region 1702 1728 N/A INTRINSIC
Pfam:APC_basic 1786 2122 1.3e-122 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele display gradual postnatal growth retardation, abnormal lamination of the cerebral cortex, hippocampus, olfactory bulb and cerebellum, impaired neuronal migration and impaired coordination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A T 2: 32,574,618 probably benign Het
Aagab G C 9: 63,636,456 A231P possibly damaging Het
Adgra3 C T 5: 49,999,195 D398N probably benign Het
Ap3b1 A T 13: 94,472,805 D616V possibly damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cdk6 G T 5: 3,344,444 K26N possibly damaging Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Col6a4 A G 9: 106,060,072 I1415T probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cpz T C 5: 35,506,704 N496D probably damaging Het
Cyp3a59 A G 5: 146,087,387 D61G probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Dbn1 A T 13: 55,477,542 probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhrs7c G A 11: 67,809,794 V56M probably damaging Het
Dnhd1 T A 7: 105,714,808 H4122Q probably benign Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Glt8d2 T C 10: 82,652,040 probably benign Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hcar2 G A 5: 123,865,197 T81M probably benign Het
Herpud2 G A 9: 25,124,989 P125L probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 T C 19: 43,384,764 Y142C probably damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Kcnk10 T C 12: 98,435,159 N405S possibly damaging Het
Klhl14 A T 18: 21,557,972 probably null Het
L3mbtl3 T A 10: 26,292,770 E587V unknown Het
Leap2 A T 11: 53,422,826 F40I probably damaging Het
Leng8 T A 7: 4,144,931 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Mansc1 T C 6: 134,610,662 H184R probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Med23 T C 10: 24,874,683 probably null Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Mrpl17 T C 7: 105,810,053 N112S probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp14 A T 7: 107,182,655 H353L probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nphp3 T C 9: 104,002,994 S72P probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olfr948 T C 9: 39,319,585 T10A probably benign Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pi4ka A G 16: 17,358,361 S405P probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prkar2a G A 9: 108,745,624 probably null Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Psg25 A T 7: 18,524,913 D279E probably benign Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Rnf168 C A 16: 32,299,196 T525K probably benign Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Sec63 T A 10: 42,789,393 Y106* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slc6a1 T A 6: 114,302,533 I91N possibly damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
St8sia1 G A 6: 142,914,134 L90F probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Thsd4 T A 9: 59,989,030 Y657F probably benign Het
Thsd7a A T 6: 12,327,660 C1404* probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Trim3 T A 7: 105,617,840 H444L probably damaging Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vmn2r19 G T 6: 123,309,841 K144N probably benign Het
Wdr41 C T 13: 95,015,174 Q281* probably null Het
Zfp938 T A 10: 82,226,123 Q221L probably benign Het
Other mutations in Apc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Apc2 APN 10 80311986 missense probably damaging 1.00
IGL01154:Apc2 APN 10 80313069 missense possibly damaging 0.90
IGL01411:Apc2 APN 10 80315078 missense probably damaging 0.99
IGL01598:Apc2 APN 10 80313048 missense probably damaging 1.00
IGL01621:Apc2 APN 10 80306201 missense probably damaging 1.00
IGL01720:Apc2 APN 10 80314499 missense probably benign 0.01
IGL01837:Apc2 APN 10 80314658 missense probably benign 0.24
IGL01933:Apc2 APN 10 80311740 missense probably damaging 1.00
IGL02243:Apc2 APN 10 80302341 missense probably damaging 1.00
IGL02292:Apc2 APN 10 80302424 missense possibly damaging 0.59
IGL02956:Apc2 APN 10 80306375 missense probably damaging 1.00
IGL03081:Apc2 APN 10 80312252 missense probably damaging 1.00
IGL03172:Apc2 APN 10 80313386 missense probably damaging 0.98
LCD18:Apc2 UTSW 10 80299974 intron probably benign
R0278:Apc2 UTSW 10 80312813 missense possibly damaging 0.90
R0501:Apc2 UTSW 10 80315124 missense probably damaging 1.00
R0594:Apc2 UTSW 10 80306256 nonsense probably null
R0607:Apc2 UTSW 10 80314101 missense probably benign
R0624:Apc2 UTSW 10 80314583 missense probably benign 0.00
R0633:Apc2 UTSW 10 80307455 missense probably damaging 0.99
R0638:Apc2 UTSW 10 80304967 missense probably damaging 0.99
R0647:Apc2 UTSW 10 80304928 missense probably damaging 1.00
R0830:Apc2 UTSW 10 80315405 missense probably damaging 1.00
R1071:Apc2 UTSW 10 80311502 missense probably damaging 1.00
R1221:Apc2 UTSW 10 80306380 missense probably damaging 1.00
R1432:Apc2 UTSW 10 80312349 missense probably benign 0.00
R1579:Apc2 UTSW 10 80311345 missense probably damaging 1.00
R1654:Apc2 UTSW 10 80301842 missense possibly damaging 0.75
R1700:Apc2 UTSW 10 80312769 missense probably damaging 1.00
R1774:Apc2 UTSW 10 80309130 missense probably damaging 1.00
R1864:Apc2 UTSW 10 80313648 missense probably damaging 1.00
R1908:Apc2 UTSW 10 80314844 missense probably benign 0.05
R1915:Apc2 UTSW 10 80315867 missense probably benign
R1999:Apc2 UTSW 10 80309160 missense probably damaging 1.00
R2050:Apc2 UTSW 10 80307609 intron probably null
R2219:Apc2 UTSW 10 80309109 missense probably benign 0.41
R2393:Apc2 UTSW 10 80313069 missense possibly damaging 0.90
R3862:Apc2 UTSW 10 80307559 missense possibly damaging 0.82
R3900:Apc2 UTSW 10 80295972 unclassified probably null
R3901:Apc2 UTSW 10 80315088 missense possibly damaging 0.94
R3952:Apc2 UTSW 10 80314484 missense probably damaging 1.00
R4009:Apc2 UTSW 10 80313592 missense probably benign 0.00
R4090:Apc2 UTSW 10 80305544 missense probably damaging 0.97
R4695:Apc2 UTSW 10 80311043 missense probably damaging 1.00
R4754:Apc2 UTSW 10 80314358 missense probably benign 0.01
R4807:Apc2 UTSW 10 80314362 missense probably benign 0.13
R4964:Apc2 UTSW 10 80314007 missense probably benign 0.14
R5056:Apc2 UTSW 10 80301314 missense probably benign
R5057:Apc2 UTSW 10 80309069 missense probably damaging 0.99
R5165:Apc2 UTSW 10 80315850 missense probably damaging 0.99
R5241:Apc2 UTSW 10 80312234 missense probably benign
R5649:Apc2 UTSW 10 80314138 missense probably damaging 1.00
R5924:Apc2 UTSW 10 80312150 missense probably damaging 1.00
R6124:Apc2 UTSW 10 80306351 missense probably damaging 0.98
R6218:Apc2 UTSW 10 80306420 missense probably damaging 0.98
R6376:Apc2 UTSW 10 80312654 missense probably damaging 1.00
R6490:Apc2 UTSW 10 80313923 missense probably benign 0.01
R6572:Apc2 UTSW 10 80311779 missense probably damaging 1.00
R6620:Apc2 UTSW 10 80313567 missense probably damaging 0.97
R7171:Apc2 UTSW 10 80315336 missense possibly damaging 0.65
R7180:Apc2 UTSW 10 80311156 missense possibly damaging 0.94
R7326:Apc2 UTSW 10 80311740 missense probably damaging 1.00
R7340:Apc2 UTSW 10 80313482 missense probably benign 0.12
R7378:Apc2 UTSW 10 80311394 missense probably damaging 1.00
R7384:Apc2 UTSW 10 80312624 missense probably damaging 1.00
R7431:Apc2 UTSW 10 80302183 missense possibly damaging 0.83
R7543:Apc2 UTSW 10 80314886 missense possibly damaging 0.72
R7743:Apc2 UTSW 10 80304915 missense probably damaging 0.99
R7759:Apc2 UTSW 10 80311196 missense probably damaging 1.00
X0018:Apc2 UTSW 10 80312264 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- GCAGAGATGTATCAGCTTGGCC -3'
(R):5'- GATCTTAGTGGAAGTTGTGCCCC -3'

Sequencing Primer
(F):5'- CCGGACCCAGGTGCCTG -3'
(R):5'- GAAGTTGTGCCCCGTTTCTCAG -3'
Posted On2016-03-17