Incidental Mutation 'R4886:Wdr41'
ID375760
Institutional Source Beutler Lab
Gene Symbol Wdr41
Ensembl Gene ENSMUSG00000042015
Gene NameWD repeat domain 41
SynonymsB830029I03Rik, MSTP048
MMRRC Submission 042492-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4886 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location94976344-95023314 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 95015174 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 281 (Q281*)
Ref Sequence ENSEMBL: ENSMUSP00000124033 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056512] [ENSMUST00000159647] [ENSMUST00000160115] [ENSMUST00000160801] [ENSMUST00000167155] [ENSMUST00000222995]
Predicted Effect probably null
Transcript: ENSMUST00000056512
AA Change: Q281*
SMART Domains Protein: ENSMUSP00000055145
Gene: ENSMUSG00000042015
AA Change: Q281*

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159647
SMART Domains Protein: ENSMUSP00000138501
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000160115
SMART Domains Protein: ENSMUSP00000138543
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 1e-5 BLAST
internal_repeat_2 224 281 1.46e-11 PROSPERO
internal_repeat_1 233 315 2.35e-20 PROSPERO
internal_repeat_2 306 365 1.46e-11 PROSPERO
internal_repeat_1 353 435 2.35e-20 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160409
SMART Domains Protein: ENSMUSP00000138569
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
internal_repeat_2 1 37 2.8e-14 PROSPERO
internal_repeat_1 2 42 7.42e-17 PROSPERO
internal_repeat_1 38 78 7.42e-17 PROSPERO
internal_repeat_2 43 79 2.8e-14 PROSPERO
Predicted Effect probably null
Transcript: ENSMUST00000160801
AA Change: Q281*
SMART Domains Protein: ENSMUSP00000124033
Gene: ENSMUSG00000042015
AA Change: Q281*

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
WD40 211 249 2.86e0 SMART
WD40 308 350 7.92e-3 SMART
WD40 394 432 1.67e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000167155
SMART Domains Protein: ENSMUSP00000129595
Gene: ENSMUSG00000042015

DomainStartEndE-ValueType
WD40 32 70 4.48e-2 SMART
WD40 73 119 1.24e-4 SMART
WD40 122 159 1.28e1 SMART
Blast:WD40 162 199 9e-6 BLAST
internal_repeat_1 233 260 6.23e-8 PROSPERO
internal_repeat_1 269 309 6.23e-8 PROSPERO
Predicted Effect noncoding transcript
Transcript: ENSMUST00000222948
Predicted Effect probably benign
Transcript: ENSMUST00000222995
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223422
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223486
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a protein of unknown function, but which contains a WD40 domain consisting of six WD40 repeats. The WD40 domain is one of the most abundant protein domains in eukaryotes, and is found in proteins with widely varying cellular functions. However, proteins with this domain often provide a rigid scaffold for protein-protein interactions. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A T 2: 32,574,618 probably benign Het
Aagab G C 9: 63,636,456 A231P possibly damaging Het
Adgra3 C T 5: 49,999,195 D398N probably benign Het
Ap3b1 A T 13: 94,472,805 D616V possibly damaging Het
Apc2 T A 10: 80,314,213 H1700Q probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cdk6 G T 5: 3,344,444 K26N possibly damaging Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Col6a4 A G 9: 106,060,072 I1415T probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cpz T C 5: 35,506,704 N496D probably damaging Het
Cyp3a59 A G 5: 146,087,387 D61G probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Dbn1 A T 13: 55,477,542 probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhrs7c G A 11: 67,809,794 V56M probably damaging Het
Dnhd1 T A 7: 105,714,808 H4122Q probably benign Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Glt8d2 T C 10: 82,652,040 probably benign Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hcar2 G A 5: 123,865,197 T81M probably benign Het
Herpud2 G A 9: 25,124,989 P125L probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 T C 19: 43,384,764 Y142C probably damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Kcnk10 T C 12: 98,435,159 N405S possibly damaging Het
Klhl14 A T 18: 21,557,972 probably null Het
L3mbtl3 T A 10: 26,292,770 E587V unknown Het
Leap2 A T 11: 53,422,826 F40I probably damaging Het
Leng8 T A 7: 4,144,931 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Mansc1 T C 6: 134,610,662 H184R probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Med23 T C 10: 24,874,683 probably null Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Mrpl17 T C 7: 105,810,053 N112S probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp14 A T 7: 107,182,655 H353L probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nphp3 T C 9: 104,002,994 S72P probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr1472 T C 19: 13,454,521 probably null Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olfr948 T C 9: 39,319,585 T10A probably benign Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pi4ka A G 16: 17,358,361 S405P probably damaging Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prkar2a G A 9: 108,745,624 probably null Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Psg25 A T 7: 18,524,913 D279E probably benign Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Rnf168 C A 16: 32,299,196 T525K probably benign Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Sec63 T A 10: 42,789,393 Y106* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slc6a1 T A 6: 114,302,533 I91N possibly damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
St8sia1 G A 6: 142,914,134 L90F probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Thsd4 T A 9: 59,989,030 Y657F probably benign Het
Thsd7a A T 6: 12,327,660 C1404* probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Trim3 T A 7: 105,617,840 H444L probably damaging Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vmn2r19 G T 6: 123,309,841 K144N probably benign Het
Zfp938 T A 10: 82,226,123 Q221L probably benign Het
Other mutations in Wdr41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02096:Wdr41 APN 13 95017456 unclassified probably benign
IGL02813:Wdr41 APN 13 94995245 splice site probably null
gogi UTSW 13 95015217 critical splice donor site probably null
metallica UTSW 13 95015174 nonsense probably null
R0047:Wdr41 UTSW 13 95010287 missense probably damaging 1.00
R0110:Wdr41 UTSW 13 95018111 unclassified probably benign
R0243:Wdr41 UTSW 13 95017406 missense probably damaging 1.00
R0537:Wdr41 UTSW 13 94995305 splice site probably benign
R2025:Wdr41 UTSW 13 95018948 missense probably damaging 1.00
R2116:Wdr41 UTSW 13 95015029 critical splice acceptor site probably null
R3953:Wdr41 UTSW 13 94997063 missense probably damaging 1.00
R5055:Wdr41 UTSW 13 95015217 critical splice donor site probably null
R5266:Wdr41 UTSW 13 94995251 missense probably damaging 1.00
R5276:Wdr41 UTSW 13 95017450 critical splice donor site probably null
R5738:Wdr41 UTSW 13 94978488 missense possibly damaging 0.55
R5957:Wdr41 UTSW 13 94997187 critical splice donor site probably null
R6682:Wdr41 UTSW 13 95013131 missense probably damaging 1.00
R6815:Wdr41 UTSW 13 95018174 missense probably damaging 1.00
R6817:Wdr41 UTSW 13 94997304 intron probably null
R7582:Wdr41 UTSW 13 95005767 missense probably damaging 0.97
R7832:Wdr41 UTSW 13 95015193 missense probably benign 0.06
R7915:Wdr41 UTSW 13 95015193 missense probably benign 0.06
R8003:Wdr41 UTSW 13 95013146 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- TGGTCTTCACATTGACACTCTAATC -3'
(R):5'- GGATCCTGTCCATTGAACTTCAG -3'

Sequencing Primer
(F):5'- AGTTCTAGCCTAGAGACCATGATTGG -3'
(R):5'- GTCCATTGAACTTCAGTTATAAGTGC -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.
 

PCR Primers

R48860088_PCR_F: 5’- TGGTCTTCACATTGACACTCTAATC-3’

R48860088_PCR_R: 5’- GGATCCTGTCCATTGAACTTCAG-3’

 

Sequencing Primers

R48860088_SEQ_F: 5’- AGTTCTAGCCTAGAGACCATGATTGG-3’
 

R48860088_SEQ_R: 5’- GTCCATTGAACTTCAGTTATAAGTGC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 441 nucleotides is amplified (NCBI RefSeq: NC_000079, chromosome 13:95014918-95015358):

 

tggtcttcac attgacactc taatctttct gattagcttg tcaccttaac acatttttta       

gttctagcct agagaccatg attggtaatg gagcatttgt gaacttttcc tagatacagg       

tttcgtcact ggctcccacg ttggcgagct gctcatctgg gatgccctgg actggactgt      

gcaggcctgt gagcgcacct tctggagccc gaccgcacag ctggatgccc agcaggaaat      

aaagctcttc caaaaacaaa atgatatttc tattaatcat ttcacatgcg atgaagaggt      

aggtagtata attgttgcaa ataaaattag tatctggtat ttaaagcctt ctatattaga      

tataaaaagt tatgattctg ggttgttgag agggctcagt gtgcaaaagc acttataact      

gaagttcaat ggacaggatc c

  

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = C>T).

Posted On2016-03-17