Incidental Mutation 'R4886:Hnrnpul2'
ID 375778
Institutional Source Beutler Lab
Gene Symbol Hnrnpul2
Ensembl Gene ENSMUSG00000071659
Gene Name heterogeneous nuclear ribonucleoprotein U-like 2
Synonyms 1110031M08Rik, Hnrpul2
MMRRC Submission 042492-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.865) question?
Stock # R4886 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 8797374-8811507 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 8807191 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 618 (P618S)
Ref Sequence ENSEMBL: ENSMUSP00000094515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096753]
AlphaFold Q00PI9
Predicted Effect probably benign
Transcript: ENSMUST00000096753
AA Change: P618S

PolyPhen 2 Score 0.202 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000094515
Gene: ENSMUSG00000071659
AA Change: P618S

DomainStartEndE-ValueType
SAP 3 37 6.03e-9 SMART
low complexity region 68 126 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
SPRY 287 416 5.23e-32 SMART
Pfam:AAA_33 452 597 1.2e-25 PFAM
low complexity region 637 666 N/A INTRINSIC
low complexity region 700 719 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A T 2: 32,464,630 (GRCm39) probably benign Het
Aagab G C 9: 63,543,738 (GRCm39) A231P possibly damaging Het
Adgra3 C T 5: 50,156,537 (GRCm39) D398N probably benign Het
Ap3b1 A T 13: 94,609,313 (GRCm39) D616V possibly damaging Het
Apc2 T A 10: 80,150,047 (GRCm39) H1700Q probably damaging Het
Arsi G A 18: 61,049,723 (GRCm39) G202E probably benign Het
Atp2b4 T A 1: 133,634,518 (GRCm39) I1177L probably benign Het
Card6 T C 15: 5,134,623 (GRCm39) probably null Het
Cdk13 A G 13: 17,894,319 (GRCm39) S1103P probably benign Het
Cdk6 G T 5: 3,394,444 (GRCm39) K26N possibly damaging Het
Cfap221 T C 1: 119,861,934 (GRCm39) T614A probably damaging Het
Cfap221 T A 1: 119,912,488 (GRCm39) Y133F probably damaging Het
Clcc1 A G 3: 108,584,154 (GRCm39) T513A probably benign Het
Clec4g T A 8: 3,766,419 (GRCm39) probably benign Het
Cntln A C 4: 84,889,466 (GRCm39) E316D probably benign Het
Col6a4 A G 9: 105,937,271 (GRCm39) I1415T probably benign Het
Cpne2 T A 8: 95,290,592 (GRCm39) D392E probably benign Het
Cpz T C 5: 35,664,048 (GRCm39) N496D probably damaging Het
Cyp3a59 A G 5: 146,024,197 (GRCm39) D61G probably damaging Het
Cyp4a29 T C 4: 115,110,078 (GRCm39) V440A probably benign Het
Dbn1 A T 13: 55,625,355 (GRCm39) probably benign Het
Ddx46 A G 13: 55,786,012 (GRCm39) D64G unknown Het
Dhrs7c G A 11: 67,700,620 (GRCm39) V56M probably damaging Het
Dnhd1 T A 7: 105,364,015 (GRCm39) H4122Q probably benign Het
Ecm2 A T 13: 49,676,263 (GRCm39) I327F possibly damaging Het
Elavl3 T C 9: 21,937,614 (GRCm39) K189E possibly damaging Het
Enam A T 5: 88,636,593 (GRCm39) R82* probably null Het
Fat3 T A 9: 15,932,626 (GRCm39) I1436F probably benign Het
Glt8d2 T C 10: 82,487,874 (GRCm39) probably benign Het
Grin2c T C 11: 115,151,616 (GRCm39) T115A probably damaging Het
H6pd C T 4: 150,067,235 (GRCm39) V384M possibly damaging Het
Hba-x A G 11: 32,227,008 (GRCm39) E39G probably benign Het
Hcar2 G A 5: 124,003,260 (GRCm39) T81M probably benign Het
Herpud2 G A 9: 25,036,285 (GRCm39) P125L probably benign Het
Hpse2 T C 19: 43,373,203 (GRCm39) Y142C probably damaging Het
Iqcm A T 8: 76,615,228 (GRCm39) R436S possibly damaging Het
Itih1 A G 14: 30,658,658 (GRCm39) probably null Het
Kcnk10 T C 12: 98,401,418 (GRCm39) N405S possibly damaging Het
Klhl14 A T 18: 21,691,029 (GRCm39) probably null Het
L3mbtl3 T A 10: 26,168,668 (GRCm39) E587V unknown Het
Leap2 A T 11: 53,313,653 (GRCm39) F40I probably damaging Het
Leng8 T A 7: 4,147,930 (GRCm39) probably null Het
Lrrc66 A G 5: 73,765,910 (GRCm39) F378L probably benign Het
Mansc1 T C 6: 134,587,625 (GRCm39) H184R probably benign Het
Map10 T A 8: 126,397,431 (GRCm39) Y275N probably damaging Het
Med23 T C 10: 24,750,581 (GRCm39) probably null Het
Mpp3 A G 11: 101,915,962 (GRCm39) Y55H probably benign Het
Mrpl17 T C 7: 105,459,260 (GRCm39) N112S probably benign Het
Nectin4 T C 1: 171,212,383 (GRCm39) V327A possibly damaging Het
Nlrp14 A T 7: 106,781,862 (GRCm39) H353L probably benign Het
Notch2 A T 3: 98,009,735 (GRCm39) Y554F probably damaging Het
Nphp3 T C 9: 103,880,193 (GRCm39) S72P probably damaging Het
Nrsn2 T C 2: 152,211,531 (GRCm39) K167E probably benign Het
Or14j8 A T 17: 38,262,962 (GRCm39) S318T probably benign Het
Or5b117 T C 19: 13,431,885 (GRCm39) probably null Het
Or8g30 T C 9: 39,230,881 (GRCm39) T10A probably benign Het
Or9i2 T A 19: 13,815,643 (GRCm39) E298V probably damaging Het
Osbpl9 T C 4: 108,925,564 (GRCm39) N485S probably benign Het
Pbk T A 14: 66,052,650 (GRCm39) H164Q probably damaging Het
Pfn2 G T 3: 57,754,874 (GRCm39) N10K probably damaging Het
Pi4ka A G 16: 17,176,225 (GRCm39) S405P Het
Pik3ca A G 3: 32,491,312 (GRCm39) D133G probably damaging Het
Pramel27 G T 4: 143,579,873 (GRCm39) R486L probably benign Het
Prkar2a G A 9: 108,622,823 (GRCm39) probably null Het
Prl6a1 A T 13: 27,502,983 (GRCm39) D193V probably damaging Het
Psg25 A T 7: 18,258,838 (GRCm39) D279E probably benign Het
Rad21 G T 15: 51,831,896 (GRCm39) P395Q probably damaging Het
Rnf168 C A 16: 32,118,014 (GRCm39) T525K probably benign Het
Rpn2 T C 2: 157,159,964 (GRCm39) probably null Het
Rreb1 G A 13: 38,115,034 (GRCm39) V798M possibly damaging Het
Scgb3a2 C T 18: 43,899,819 (GRCm39) P36S probably damaging Het
Scn3a T C 2: 65,291,376 (GRCm39) D1790G probably damaging Het
Sec24b A T 3: 129,777,619 (GRCm39) H1226Q probably benign Het
Sec63 T A 10: 42,665,389 (GRCm39) Y106* probably null Het
Shroom3 G T 5: 93,090,945 (GRCm39) V1151F probably damaging Het
Slc12a3 G A 8: 95,078,438 (GRCm39) probably null Het
Slc6a1 T A 6: 114,279,494 (GRCm39) I91N possibly damaging Het
Slitrk6 T C 14: 110,989,315 (GRCm39) T131A probably damaging Het
Spata1 C G 3: 146,175,529 (GRCm39) D326H probably damaging Het
St8sia1 G A 6: 142,859,860 (GRCm39) L90F probably damaging Het
Thsd4 T A 9: 59,896,313 (GRCm39) Y657F probably benign Het
Thsd7a A T 6: 12,327,659 (GRCm39) C1404* probably null Het
Tma16 A C 8: 66,934,129 (GRCm39) C75W probably damaging Het
Trgv4 T C 13: 19,369,236 (GRCm39) V29A probably benign Het
Trim3 T A 7: 105,267,047 (GRCm39) H444L probably damaging Het
Trmt10a A T 3: 137,854,146 (GRCm39) K75* probably null Het
Ttn T C 2: 76,561,644 (GRCm39) D28954G probably damaging Het
Uggt2 A G 14: 119,273,376 (GRCm39) probably null Het
Vars1 T A 17: 35,234,702 (GRCm39) V1177E probably benign Het
Vmn2r114 G T 17: 23,527,008 (GRCm39) A508E probably benign Het
Vmn2r19 G T 6: 123,286,800 (GRCm39) K144N probably benign Het
Wdr41 C T 13: 95,151,682 (GRCm39) Q281* probably null Het
Zfp938 T A 10: 82,061,957 (GRCm39) Q221L probably benign Het
Other mutations in Hnrnpul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Hnrnpul2 APN 19 8,800,992 (GRCm39) missense probably damaging 1.00
R0136:Hnrnpul2 UTSW 19 8,804,165 (GRCm39) missense probably damaging 1.00
R0369:Hnrnpul2 UTSW 19 8,801,777 (GRCm39) missense probably damaging 1.00
R0781:Hnrnpul2 UTSW 19 8,804,110 (GRCm39) missense probably damaging 1.00
R0784:Hnrnpul2 UTSW 19 8,802,416 (GRCm39) missense possibly damaging 0.82
R1110:Hnrnpul2 UTSW 19 8,804,110 (GRCm39) missense probably damaging 1.00
R1227:Hnrnpul2 UTSW 19 8,800,601 (GRCm39) missense possibly damaging 0.91
R1589:Hnrnpul2 UTSW 19 8,808,696 (GRCm39) missense probably benign 0.00
R2126:Hnrnpul2 UTSW 19 8,801,802 (GRCm39) nonsense probably null
R2226:Hnrnpul2 UTSW 19 8,802,349 (GRCm39) missense probably damaging 0.96
R2243:Hnrnpul2 UTSW 19 8,798,001 (GRCm39) missense probably benign
R3703:Hnrnpul2 UTSW 19 8,801,773 (GRCm39) missense probably damaging 1.00
R4038:Hnrnpul2 UTSW 19 8,800,591 (GRCm39) unclassified probably benign
R4856:Hnrnpul2 UTSW 19 8,807,191 (GRCm39) missense probably benign 0.20
R5016:Hnrnpul2 UTSW 19 8,800,189 (GRCm39) missense possibly damaging 0.94
R5365:Hnrnpul2 UTSW 19 8,798,080 (GRCm39) missense probably benign
R5435:Hnrnpul2 UTSW 19 8,797,682 (GRCm39) missense probably benign 0.32
R5951:Hnrnpul2 UTSW 19 8,802,255 (GRCm39) missense probably damaging 1.00
R6181:Hnrnpul2 UTSW 19 8,800,596 (GRCm39) missense possibly damaging 0.70
R6824:Hnrnpul2 UTSW 19 8,804,081 (GRCm39) missense possibly damaging 0.89
R6924:Hnrnpul2 UTSW 19 8,808,873 (GRCm39) missense unknown
R6978:Hnrnpul2 UTSW 19 8,801,640 (GRCm39) missense probably damaging 1.00
R7602:Hnrnpul2 UTSW 19 8,808,673 (GRCm39) missense probably damaging 0.99
R7688:Hnrnpul2 UTSW 19 8,797,994 (GRCm39) missense probably benign
R7726:Hnrnpul2 UTSW 19 8,808,644 (GRCm39) missense possibly damaging 0.61
R7749:Hnrnpul2 UTSW 19 8,797,788 (GRCm39) missense probably benign
R7753:Hnrnpul2 UTSW 19 8,802,336 (GRCm39) missense probably damaging 1.00
R8007:Hnrnpul2 UTSW 19 8,798,179 (GRCm39) critical splice donor site probably null
R8725:Hnrnpul2 UTSW 19 8,798,064 (GRCm39) missense probably benign 0.00
R8727:Hnrnpul2 UTSW 19 8,798,064 (GRCm39) missense probably benign 0.00
R8901:Hnrnpul2 UTSW 19 8,801,809 (GRCm39) missense probably damaging 0.98
R8994:Hnrnpul2 UTSW 19 8,802,350 (GRCm39) missense probably damaging 1.00
R9012:Hnrnpul2 UTSW 19 8,801,829 (GRCm39) missense possibly damaging 0.69
R9187:Hnrnpul2 UTSW 19 8,808,319 (GRCm39) missense probably benign 0.28
R9347:Hnrnpul2 UTSW 19 8,798,080 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCAAGGCAGTTAAGGCTAG -3'
(R):5'- ATCAGGAAAGCTGCTCACTGTG -3'

Sequencing Primer
(F):5'- TTAACATTTGCAAAGCCCTGG -3'
(R):5'- TGGGCAGCCAGGTCTCTAG -3'
Posted On 2016-03-17