Incidental Mutation 'R4886:Olfr1472'
ID 375779
Institutional Source Beutler Lab
Gene Symbol Olfr1472
Ensembl Gene ENSMUSG00000095189
Gene Name olfactory receptor 1472
Synonyms GA_x6K02T2RE5P-3787124-3786180, MOR202-16
MMRRC Submission 042492-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.150) question?
Stock # R4886 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 13453280-13456086 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) T to C at 13454521 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000076707 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077501] [ENSMUST00000096201]
AlphaFold Q7TQQ9
Predicted Effect probably null
Transcript: ENSMUST00000077501
SMART Domains Protein: ENSMUSP00000076707
Gene: ENSMUSG00000095189

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 2.4e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 5.2e-8 PFAM
Pfam:7tm_1 39 288 6.9e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000096201
SMART Domains Protein: ENSMUSP00000093915
Gene: ENSMUSG00000095189

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 3.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 34 304 2.6e-6 PFAM
Pfam:7tm_1 40 289 1.2e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213561
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430097D07Rik A T 2: 32,574,618 probably benign Het
Aagab G C 9: 63,636,456 A231P possibly damaging Het
Adgra3 C T 5: 49,999,195 D398N probably benign Het
Ap3b1 A T 13: 94,472,805 D616V possibly damaging Het
Apc2 T A 10: 80,314,213 H1700Q probably damaging Het
Arsi G A 18: 60,916,651 G202E probably benign Het
Atp2b4 T A 1: 133,706,780 I1177L probably benign Het
Card6 T C 15: 5,105,141 probably null Het
Cdk13 A G 13: 17,719,734 S1103P probably benign Het
Cdk6 G T 5: 3,344,444 K26N possibly damaging Het
Cfap221 T C 1: 119,934,204 T614A probably damaging Het
Cfap221 T A 1: 119,984,758 Y133F probably damaging Het
Clcc1 A G 3: 108,676,838 T513A probably benign Het
Clec4g T A 8: 3,716,419 probably benign Het
Cntln A C 4: 84,971,229 E316D probably benign Het
Col6a4 A G 9: 106,060,072 I1415T probably benign Het
Cpne2 T A 8: 94,563,964 D392E probably benign Het
Cpz T C 5: 35,506,704 N496D probably damaging Het
Cyp3a59 A G 5: 146,087,387 D61G probably damaging Het
Cyp4a29 T C 4: 115,252,881 V440A probably benign Het
Dbn1 A T 13: 55,477,542 probably benign Het
Ddx46 A G 13: 55,638,199 D64G unknown Het
Dhrs7c G A 11: 67,809,794 V56M probably damaging Het
Dnhd1 T A 7: 105,714,808 H4122Q probably benign Het
Ecm2 A T 13: 49,522,787 I327F possibly damaging Het
Elavl3 T C 9: 22,026,318 K189E possibly damaging Het
Enam A T 5: 88,488,734 R82* probably null Het
Fat3 T A 9: 16,021,330 I1436F probably benign Het
Glt8d2 T C 10: 82,652,040 probably benign Het
Gm13103 G T 4: 143,853,303 R486L probably benign Het
Grin2c T C 11: 115,260,790 T115A probably damaging Het
H6pd C T 4: 149,982,778 V384M possibly damaging Het
Hba-x A G 11: 32,277,008 E39G probably benign Het
Hcar2 G A 5: 123,865,197 T81M probably benign Het
Herpud2 G A 9: 25,124,989 P125L probably benign Het
Hnrnpul2 C T 19: 8,829,827 P618S probably benign Het
Hpse2 T C 19: 43,384,764 Y142C probably damaging Het
Iqcm A T 8: 75,888,600 R436S possibly damaging Het
Itih1 A G 14: 30,936,701 probably null Het
Kcnk10 T C 12: 98,435,159 N405S possibly damaging Het
Klhl14 A T 18: 21,557,972 probably null Het
L3mbtl3 T A 10: 26,292,770 E587V unknown Het
Leap2 A T 11: 53,422,826 F40I probably damaging Het
Leng8 T A 7: 4,144,931 probably null Het
Lrrc66 A G 5: 73,608,567 F378L probably benign Het
Mansc1 T C 6: 134,610,662 H184R probably benign Het
Map10 T A 8: 125,670,692 Y275N probably damaging Het
Med23 T C 10: 24,874,683 probably null Het
Mpp3 A G 11: 102,025,136 Y55H probably benign Het
Mrpl17 T C 7: 105,810,053 N112S probably benign Het
Nectin4 T C 1: 171,384,815 V327A possibly damaging Het
Nlrp14 A T 7: 107,182,655 H353L probably benign Het
Notch2 A T 3: 98,102,419 Y554F probably damaging Het
Nphp3 T C 9: 104,002,994 S72P probably damaging Het
Nrsn2 T C 2: 152,369,611 K167E probably benign Het
Olfr1501 T A 19: 13,838,279 E298V probably damaging Het
Olfr761 A T 17: 37,952,071 S318T probably benign Het
Olfr948 T C 9: 39,319,585 T10A probably benign Het
Osbpl9 T C 4: 109,068,367 N485S probably benign Het
Pbk T A 14: 65,815,201 H164Q probably damaging Het
Pfn2 G T 3: 57,847,453 N10K probably damaging Het
Pi4ka A G 16: 17,358,361 S405P Het
Pik3ca A G 3: 32,437,163 D133G probably damaging Het
Prkar2a G A 9: 108,745,624 probably null Het
Prl6a1 A T 13: 27,319,000 D193V probably damaging Het
Psg25 A T 7: 18,524,913 D279E probably benign Het
Rad21 G T 15: 51,968,500 P395Q probably damaging Het
Rnf168 C A 16: 32,299,196 T525K probably benign Het
Rpn2 T C 2: 157,318,044 probably null Het
Rreb1 G A 13: 37,931,058 V798M possibly damaging Het
Scgb3a2 C T 18: 43,766,754 P36S probably damaging Het
Scn3a T C 2: 65,461,032 D1790G probably damaging Het
Sec24b A T 3: 129,983,970 H1226Q probably benign Het
Sec63 T A 10: 42,789,393 Y106* probably null Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc12a3 G A 8: 94,351,810 probably null Het
Slc6a1 T A 6: 114,302,533 I91N possibly damaging Het
Slitrk6 T C 14: 110,751,883 T131A probably damaging Het
Spata1 C G 3: 146,469,774 D326H probably damaging Het
St8sia1 G A 6: 142,914,134 L90F probably damaging Het
Tcrg-V4 T C 13: 19,185,066 V29A probably benign Het
Thsd4 T A 9: 59,989,030 Y657F probably benign Het
Thsd7a A T 6: 12,327,660 C1404* probably null Het
Tma16 A C 8: 66,481,477 C75W probably damaging Het
Trim3 T A 7: 105,617,840 H444L probably damaging Het
Trmt10a A T 3: 138,148,385 K75* probably null Het
Ttn T C 2: 76,731,300 D28954G probably damaging Het
Uggt2 A G 14: 119,035,964 probably null Het
Vars T A 17: 35,015,726 V1177E probably benign Het
Vmn2r114 G T 17: 23,308,034 A508E probably benign Het
Vmn2r19 G T 6: 123,309,841 K144N probably benign Het
Wdr41 C T 13: 95,015,174 Q281* probably null Het
Zfp938 T A 10: 82,226,123 Q221L probably benign Het
Other mutations in Olfr1472
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Olfr1472 APN 19 13453840 missense possibly damaging 0.46
IGL01755:Olfr1472 APN 19 13453815 missense probably damaging 1.00
IGL01885:Olfr1472 APN 19 13454085 missense probably benign 0.00
IGL02366:Olfr1472 APN 19 13454127 missense probably damaging 1.00
IGL03074:Olfr1472 APN 19 13454053 missense probably damaging 0.98
R0592:Olfr1472 UTSW 19 13453705 missense probably benign 0.00
R1085:Olfr1472 UTSW 19 13454230 missense possibly damaging 0.75
R4207:Olfr1472 UTSW 19 13454471 missense probably benign 0.15
R4856:Olfr1472 UTSW 19 13454521 splice site probably null
R5061:Olfr1472 UTSW 19 13453985 nonsense probably null
R5167:Olfr1472 UTSW 19 13454377 missense probably damaging 1.00
R5509:Olfr1472 UTSW 19 13453968 missense probably damaging 1.00
R5586:Olfr1472 UTSW 19 13454382 missense probably benign 0.02
R5987:Olfr1472 UTSW 19 13453960 missense possibly damaging 0.57
R6631:Olfr1472 UTSW 19 13453821 missense probably benign 0.00
R7976:Olfr1472 UTSW 19 13454199 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATCACCTTGGGAGTGACAG -3'
(R):5'- GATCAGTGCCCATTTGTATCATTTC -3'

Sequencing Primer
(F):5'- TCCACCAGGGAGAGGTTAC -3'
(R):5'- TTCCATATGAATAAACTGCCTGC -3'
Posted On 2016-03-17