Mutagenetix > Incidental Mutation

Incidental Mutation 'R0281:Lama1'

37578

Institutional Source

Beutler Lab

Gene Symbol

Lama1

Ensembl Gene

ENSMUSG00000032796

Gene Name

laminin, alpha 1

Synonyms

Lama

MMRRC Submission

038503-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0281 (G1)

Quality Score

215

Status

Validated

Chromosome

Chromosomal Location

67697265-67822645 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 67817569 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Aspartic acid at position 2875 (N2875D)

Ref Sequence

ENSEMBL: ENSMUSP00000043957 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035471]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000035471
AA Change: N2875D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: N2875D

Domain	Start	End	E-Value	Type
low complexity region	3	22	N/A	INTRINSIC
LamNT	23	275	1.2e-131	SMART
EGF_Lam	277	331	1e-5	SMART
EGF_Lam	334	401	6.6e-6	SMART
EGF_Lam	404	458	9.11e-9	SMART
EGF_Lam	461	507	8.12e-6	SMART
LamB	570	702	2.09e-57	SMART
EGF_like	715	746	3.36e0	SMART
EGF_Lam	749	795	7.01e-10	SMART
EGF_Lam	798	853	3.59e-7	SMART
EGF_Lam	856	906	1.53e-10	SMART
EGF_Lam	909	955	1.13e-13	SMART
EGF_Lam	958	1002	1.36e-7	SMART
EGF_Lam	1005	1048	7.29e-8	SMART
EGF_like	1034	1082	4.83e1	SMART
EGF_Lam	1051	1094	1.67e-7	SMART
EGF_Lam	1097	1154	1.32e-5	SMART
LamB	1220	1352	8.7e-46	SMART
Pfam:Laminin_EGF	1367	1397	1.7e-6	PFAM
EGF_Lam	1410	1456	7.12e-11	SMART
EGF_Lam	1459	1513	3.25e-5	SMART
EGF_like	1497	1547	6.41e1	SMART
EGF_Lam	1516	1560	1.71e-13	SMART
Pfam:Laminin_I	1574	1838	1.7e-91	PFAM
low complexity region	2012	2031	N/A	INTRINSIC
low complexity region	2087	2098	N/A	INTRINSIC
LamG	2145	2287	3.66e-30	SMART
LamG	2332	2473	5.98e-35	SMART
LamG	2513	2661	1.11e-29	SMART
low complexity region	2695	2708	N/A	INTRINSIC
LamG	2743	2877	9.72e-35	SMART
LamG	2920	3056	4.63e-41	SMART

Meta Mutation Damage Score

0.2438

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (104/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2610507B11Rik	C	T	11: 78,271,924	L871F	possibly damaging	Het
4933430I17Rik	A	T	4: 62,546,067	R374*	probably null	Het
5930422O12Rik	A	T	8: 33,429,379	R76*	probably null	Het
A1cf	G	A	19: 31,945,814	A505T	probably benign	Het
Abcc5	T	A	16: 20,422,400	I12F	probably damaging	Het
Abcf2	T	C	5: 24,566,564	E555G	probably damaging	Het
Acan	A	T	7: 79,100,285	E1601D	probably damaging	Het
Adam2	T	A	14: 66,037,606	K559N	probably benign	Het
Akap11	A	C	14: 78,510,089	D1619E	possibly damaging	Het
Ankrd11	T	C	8: 122,895,568	D515G	probably benign	Het
Ankrd27	T	A	7: 35,619,371	N562K	probably damaging	Het
Atp10b	T	C	11: 43,153,304	I119T	probably benign	Het
Atr	T	C	9: 95,937,566	I2202T	probably benign	Het
BC067074	A	T	13: 113,369,143	I727F	probably damaging	Het
Brd4	T	A	17: 32,213,540		probably benign	Het
Catsperg2	C	T	7: 29,706,571	C634Y	possibly damaging	Het
Cep192	A	G	18: 67,828,482		probably benign	Het
Cfap65	T	A	1: 74,927,071	I366F	probably damaging	Het
Cnga4	G	T	7: 105,407,668	R326L	probably damaging	Het
Cntnap5b	T	A	1: 100,072,153	M212K	probably benign	Het
Col6a6	T	A	9: 105,784,116	M265L	probably benign	Het
Cyp26b1	A	T	6: 84,574,556	F417Y	probably damaging	Het
Dhx15	A	T	5: 52,150,746	M768K	probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Duox2	C	T	2: 122,292,304	V550M	probably benign	Het
Elmo2	A	G	2: 165,296,890	L456P	probably damaging	Het
Fbxo39	T	C	11: 72,317,530	I236T	probably benign	Het
Fezf2	A	G	14: 12,343,977	C305R	probably damaging	Het
Fndc3b	C	A	3: 27,457,006	C785F	probably benign	Het
Gm12253	T	C	11: 58,440,012		probably benign	Het
Gnat2	T	A	3: 108,095,562	Y95*	probably null	Het
Gopc	T	C	10: 52,350,678	K220E	probably damaging	Het
Hectd4	G	A	5: 121,254,251	D193N	possibly damaging	Het
Hexa	G	A	9: 59,554,226		probably null	Het
Hspa4l	T	C	3: 40,785,408		probably benign	Het
Hspa5	T	C	2: 34,774,320	S301P	probably damaging	Het
Ice1	A	T	13: 70,604,047	S1307T	possibly damaging	Het
Igtp	T	C	11: 58,206,054	L17P	probably damaging	Het
Itk	T	C	11: 46,353,916	Y225C	probably damaging	Het
Kifc3	A	G	8: 95,103,460	V560A	probably damaging	Het
Lasp1	C	A	11: 97,806,851	C32*	probably null	Het
Lcp2	T	A	11: 34,069,854		probably benign	Het
Lhx9	C	T	1: 138,832,904	G236D	probably benign	Het
Lrrc38	A	T	4: 143,350,409	I81F	probably damaging	Het
Ly6a	C	T	15: 74,995,387	V94M	probably benign	Het
Map3k13	A	G	16: 21,914,157	E503G	probably damaging	Het
Mertk	T	C	2: 128,782,621		probably benign	Het
Mkl2	T	A	16: 13,412,163	I915N	probably damaging	Het
Msantd2	G	A	9: 37,523,219	D252N	possibly damaging	Het
Mtmr12	T	A	15: 12,257,706	L290*	probably null	Het
Myo3a	T	C	2: 22,245,598	I92T	probably benign	Het
Naglu	T	A	11: 101,074,027	N313K	probably damaging	Het
Nceh1	T	C	3: 27,222,804	V92A	possibly damaging	Het
Ncf4	A	G	15: 78,250,883	T47A	probably damaging	Het
Nrp1	T	A	8: 128,460,683	F403L	probably damaging	Het
Nxph3	T	C	11: 95,511,256	T111A	possibly damaging	Het
Obscn	T	A	11: 59,038,615	E6061V	probably damaging	Het
Obsl1	C	A	1: 75,492,927	G1149W	probably damaging	Het
Olfr1162	C	T	2: 88,050,412	V71I	possibly damaging	Het
Olfr1370	T	A	13: 21,072,374	Y309F	probably benign	Het
Olfr1487	A	G	19: 13,619,485	T65A	probably benign	Het
Olfr267	A	T	4: 58,784,981	V247E	probably damaging	Het
Olfr292	A	G	7: 86,694,860	T135A	probably benign	Het
Olfr493	A	C	7: 108,346,914	D22E	probably benign	Het
Olfr814	T	A	10: 129,874,546	L70F	possibly damaging	Het
Pde9a	T	C	17: 31,455,106	V55A	probably damaging	Het
Pip4k2c	A	T	10: 127,205,821		probably null	Het
Plvap	T	C	8: 71,511,382	N112S	probably damaging	Het
Pop1	T	A	15: 34,529,858		probably null	Het
Ppip5k2	T	C	1: 97,716,553	H1113R	possibly damaging	Het
Ptprk	A	T	10: 28,573,392	I962F	probably damaging	Het
Rad51ap2	T	C	12: 11,457,042	S322P	possibly damaging	Het
Rasal1	A	G	5: 120,674,605	T565A	probably benign	Het
Rbm15	C	A	3: 107,331,155	R642S	probably damaging	Het
Rpsa	G	A	9: 120,131,003	E211K	possibly damaging	Het
Ryr3	A	G	2: 112,686,810	S3303P	probably damaging	Het
Scg2	T	A	1: 79,435,512	N458I	possibly damaging	Het
Setx	A	G	2: 29,179,643	T2487A	probably benign	Het
Slc4a5	G	A	6: 83,267,567		probably benign	Het
Slc8a2	T	A	7: 16,140,989	D387E	probably benign	Het
Smarcc2	A	G	10: 128,474,722	T407A	probably benign	Het
Snap25	A	G	2: 136,777,464	D179G	probably damaging	Het
Socs4	T	C	14: 47,289,868	S74P	probably benign	Het
Sp6	T	A	11: 97,021,925	Y155N	probably benign	Het
Srrt	C	T	5: 137,296,127		probably benign	Het
Steap1	C	T	5: 5,736,431	M335I	probably benign	Het
Stra6	A	T	9: 58,145,489	Y250F	probably benign	Het
Svil	T	C	18: 5,094,582	S1421P	probably damaging	Het
Tcea3	G	A	4: 136,271,366	C317Y	probably damaging	Het
Tmco6	T	C	18: 36,737,704	L117S	probably damaging	Het
Trp53bp1	T	C	2: 121,270,237	K89E	probably damaging	Het
Trp63	T	A	16: 25,764,302		probably benign	Het
Ube2d2a	A	G	18: 35,800,132	Y74C	probably damaging	Het
Usp19	T	G	9: 108,498,509	F885V	probably damaging	Het
Utp18	T	A	11: 93,882,177		probably benign	Het
Vmn2r116	T	C	17: 23,401,413	I707T	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Zfp318	C	T	17: 46,412,614	P1848S	probably benign	Het
Zfp984	G	T	4: 147,755,265	N376K	probably benign	Het

Other mutations in Lama1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00157:Lama1	APN	17	67815928	missense	probably benign
IGL00336:Lama1	APN	17	67813948	missense	probably benign	0.07
IGL01066:Lama1	APN	17	67743326	missense	probably damaging	1.00
IGL01140:Lama1	APN	17	67802933	missense	probably benign	0.14
IGL01291:Lama1	APN	17	67738870	missense	probably damaging	1.00
IGL01296:Lama1	APN	17	67745051	missense	probably benign	0.27
IGL01317:Lama1	APN	17	67818701	missense	probably damaging	1.00
IGL01490:Lama1	APN	17	67750584	missense	possibly damaging	0.54
IGL01506:Lama1	APN	17	67785070	missense	probably benign	0.01
IGL01508:Lama1	APN	17	67809361	splice site	probably benign
IGL01522:Lama1	APN	17	67752774	splice site	probably benign
IGL01530:Lama1	APN	17	67796790	missense	probably benign	0.02
IGL01541:Lama1	APN	17	67785070	missense	probably benign	0.01
IGL01677:Lama1	APN	17	67779148	missense	probably benign	0.15
IGL01886:Lama1	APN	17	67807797	missense	probably benign	0.36
IGL01994:Lama1	APN	17	67752439	missense	probably benign	0.05
IGL02017:Lama1	APN	17	67764725	missense	probably benign	0.00
IGL02021:Lama1	APN	17	67821626	missense	probably damaging	1.00
IGL02026:Lama1	APN	17	67809292	missense	possibly damaging	0.82
IGL02044:Lama1	APN	17	67811490	missense	probably benign	0.01
IGL02120:Lama1	APN	17	67716789	missense	probably damaging	1.00
IGL02425:Lama1	APN	17	67811485	missense	probably benign	0.45
IGL02549:Lama1	APN	17	67790835	missense	possibly damaging	0.93
IGL02642:Lama1	APN	17	67812366	missense	probably benign	0.00
IGL02795:Lama1	APN	17	67738894	splice site	probably null
IGL02798:Lama1	APN	17	67795191	splice site	probably benign
IGL02863:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02870:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02876:Lama1	APN	17	67750692	critical splice donor site	probably null
IGL02885:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02891:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL02978:Lama1	APN	17	67786081	nonsense	probably null
IGL03064:Lama1	APN	17	67779104	missense	probably benign	0.01
IGL03076:Lama1	APN	17	67716799	missense	possibly damaging	0.95
IGL03110:Lama1	APN	17	67798986	missense	probably benign	0.04
IGL03143:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL03159:Lama1	APN	17	67804536	missense	probably damaging	0.99
IGL03268:Lama1	APN	17	67804536	missense	probably damaging	0.99
ANU05:Lama1	UTSW	17	67738870	missense	probably damaging	1.00
PIT4472001:Lama1	UTSW	17	67764704	missense
R0047:Lama1	UTSW	17	67795186	splice site	probably benign
R0047:Lama1	UTSW	17	67795186	splice site	probably benign
R0050:Lama1	UTSW	17	67782056	missense	possibly damaging	0.66
R0096:Lama1	UTSW	17	67805413	missense	probably benign	0.12
R0096:Lama1	UTSW	17	67805413	missense	probably benign	0.12
R0111:Lama1	UTSW	17	67737498	missense	probably damaging	0.98
R0116:Lama1	UTSW	17	67776923	missense	probably benign	0.10
R0121:Lama1	UTSW	17	67798513	splice site	probably benign
R0278:Lama1	UTSW	17	67810183	missense	probably null	0.98
R0312:Lama1	UTSW	17	67775851	missense	possibly damaging	0.45
R0419:Lama1	UTSW	17	67791610	critical splice donor site	probably null
R0512:Lama1	UTSW	17	67779134	missense	possibly damaging	0.67
R0514:Lama1	UTSW	17	67764698	missense	probably benign	0.40
R0562:Lama1	UTSW	17	67815959	missense	probably damaging	1.00
R0632:Lama1	UTSW	17	67752368	splice site	probably benign
R0645:Lama1	UTSW	17	67773712	missense	probably benign	0.01
R0712:Lama1	UTSW	17	67779042	splice site	probably null
R0763:Lama1	UTSW	17	67772818	missense	probably damaging	0.97
R0941:Lama1	UTSW	17	67775865	missense	probably benign	0.10
R1025:Lama1	UTSW	17	67752898	missense	probably benign	0.00
R1084:Lama1	UTSW	17	67804469	missense	probably benign	0.12
R1103:Lama1	UTSW	17	67790947	missense	probably damaging	0.98
R1420:Lama1	UTSW	17	67790947	missense	probably damaging	0.98
R1430:Lama1	UTSW	17	67782155	missense	possibly damaging	0.95
R1569:Lama1	UTSW	17	67780618	splice site	probably null
R1575:Lama1	UTSW	17	67810409	missense	possibly damaging	0.96
R1613:Lama1	UTSW	17	67807923	missense	probably benign	0.42
R1620:Lama1	UTSW	17	67767033	missense	probably benign	0.01
R1629:Lama1	UTSW	17	67805428	missense	probably benign	0.00
R1645:Lama1	UTSW	17	67737682	missense	probably benign	0.14
R1652:Lama1	UTSW	17	67807846	missense	probably damaging	0.97
R1674:Lama1	UTSW	17	67791244	missense	probably benign
R1678:Lama1	UTSW	17	67810155	missense	possibly damaging	0.56
R1710:Lama1	UTSW	17	67753791	missense	probably benign	0.00
R1712:Lama1	UTSW	17	67717186	missense	possibly damaging	0.95
R1737:Lama1	UTSW	17	67802921	missense	probably benign	0.36
R1757:Lama1	UTSW	17	67763836	missense	probably benign	0.40
R1757:Lama1	UTSW	17	67697383	missense	unknown
R1813:Lama1	UTSW	17	67791223	missense	probably benign
R1896:Lama1	UTSW	17	67791223	missense	probably benign
R1945:Lama1	UTSW	17	67745853	missense	probably benign	0.14
R2086:Lama1	UTSW	17	67817623	missense	probably damaging	1.00
R2149:Lama1	UTSW	17	67773865	missense	possibly damaging	0.95
R2178:Lama1	UTSW	17	67769515	missense	probably benign	0.07
R2183:Lama1	UTSW	17	67791009	missense	probably damaging	0.98
R2197:Lama1	UTSW	17	67752941	missense	probably benign	0.02
R2213:Lama1	UTSW	17	67777034	nonsense	probably null
R2260:Lama1	UTSW	17	67737507	missense	probably damaging	0.96
R2356:Lama1	UTSW	17	67810114	missense	probably damaging	1.00
R2420:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2421:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2422:Lama1	UTSW	17	67750553	missense	probably benign	0.00
R2424:Lama1	UTSW	17	67798665	missense	probably benign	0.09
R2442:Lama1	UTSW	17	67768317	missense	probably benign	0.04
R3147:Lama1	UTSW	17	67737658	missense	probably damaging	0.98
R3414:Lama1	UTSW	17	67737603	missense	probably damaging	1.00
R3683:Lama1	UTSW	17	67768333	missense	probably benign	0.40
R3820:Lama1	UTSW	17	67779046	splice site	probably null
R3821:Lama1	UTSW	17	67779046	splice site	probably null
R3822:Lama1	UTSW	17	67779046	splice site	probably null
R4012:Lama1	UTSW	17	67812373	nonsense	probably null
R4113:Lama1	UTSW	17	67764703	missense	probably benign	0.01
R4133:Lama1	UTSW	17	67750655	missense	probably damaging	0.98
R4133:Lama1	UTSW	17	67812486	missense	probably damaging	1.00
R4259:Lama1	UTSW	17	67752418	missense	possibly damaging	0.95
R4278:Lama1	UTSW	17	67791517	missense	probably null	0.00
R4321:Lama1	UTSW	17	67771083	missense	probably benign	0.03
R4374:Lama1	UTSW	17	67804518	missense	probably benign	0.00
R4386:Lama1	UTSW	17	67773712	missense	probably benign	0.01
R4463:Lama1	UTSW	17	67761700	missense	probably damaging	1.00
R4629:Lama1	UTSW	17	67805360	critical splice acceptor site	probably null
R4630:Lama1	UTSW	17	67794300	missense	probably benign	0.00
R4633:Lama1	UTSW	17	67798584	missense	probably damaging	0.96
R4668:Lama1	UTSW	17	67752434	missense	probably benign	0.27
R4684:Lama1	UTSW	17	67773778	missense	possibly damaging	0.88
R4745:Lama1	UTSW	17	67738780	missense	probably damaging	1.00
R4786:Lama1	UTSW	17	67773859	missense	possibly damaging	0.77
R4797:Lama1	UTSW	17	67716775	missense	probably benign	0.04
R4803:Lama1	UTSW	17	67809271	missense	probably damaging	1.00
R4925:Lama1	UTSW	17	67794314	missense	probably benign	0.02
R4939:Lama1	UTSW	17	67737475	missense	possibly damaging	0.91
R4952:Lama1	UTSW	17	67767566	critical splice donor site	probably null
R4975:Lama1	UTSW	17	67738834	missense	possibly damaging	0.95
R4977:Lama1	UTSW	17	67737682	missense	probably damaging	1.00
R5039:Lama1	UTSW	17	67745893	missense	possibly damaging	0.66
R5047:Lama1	UTSW	17	67743281	nonsense	probably null
R5195:Lama1	UTSW	17	67764800	missense	probably benign	0.13
R5230:Lama1	UTSW	17	67745083	nonsense	probably null
R5236:Lama1	UTSW	17	67804492	missense	probably benign	0.24
R5254:Lama1	UTSW	17	67756716	missense	probably benign	0.01
R5345:Lama1	UTSW	17	67817563	missense	probably benign
R5438:Lama1	UTSW	17	67800774	missense	possibly damaging	0.92
R5521:Lama1	UTSW	17	67780894	nonsense	probably null
R5568:Lama1	UTSW	17	67768298	critical splice acceptor site	probably null
R5645:Lama1	UTSW	17	67802948	missense	probably damaging	1.00
R5665:Lama1	UTSW	17	67770987	missense	probably damaging	1.00
R5727:Lama1	UTSW	17	67815224	missense	possibly damaging	0.81
R5757:Lama1	UTSW	17	67738787	missense	possibly damaging	0.59
R5795:Lama1	UTSW	17	67796727	missense	probably benign	0.02
R5857:Lama1	UTSW	17	67807843	missense	probably damaging	0.99
R5894:Lama1	UTSW	17	67779047	critical splice acceptor site	probably null
R5974:Lama1	UTSW	17	67773727	missense	probably benign	0.31
R6032:Lama1	UTSW	17	67750643	missense	probably benign	0.01
R6032:Lama1	UTSW	17	67750643	missense	probably benign	0.01
R6120:Lama1	UTSW	17	67780617	critical splice donor site	probably null
R6219:Lama1	UTSW	17	67790856	missense	probably benign	0.08
R6224:Lama1	UTSW	17	67802987	missense	possibly damaging	0.56
R6249:Lama1	UTSW	17	67798604	missense	probably benign
R6265:Lama1	UTSW	17	67750655	missense	probably damaging	0.98
R6276:Lama1	UTSW	17	67784088	splice site	probably null
R6284:Lama1	UTSW	17	67810096	missense	probably damaging	0.99
R6337:Lama1	UTSW	17	67786019	missense	probably benign	0.27
R6414:Lama1	UTSW	17	67746910	critical splice donor site	probably null
R6631:Lama1	UTSW	17	67774482	missense	probably benign	0.21
R6659:Lama1	UTSW	17	67818635	missense	probably damaging	1.00
R6660:Lama1	UTSW	17	67804500	missense	probably benign	0.05
R6677:Lama1	UTSW	17	67795233	missense	probably benign	0.14
R6763:Lama1	UTSW	17	67746873	missense	unknown
R6787:Lama1	UTSW	17	67784025	missense	unknown
R6831:Lama1	UTSW	17	67756754	missense	possibly damaging	0.89
R6855:Lama1	UTSW	17	67782155	missense	possibly damaging	0.95
R6910:Lama1	UTSW	17	67791464	missense	possibly damaging	0.60
R6934:Lama1	UTSW	17	67774543	missense	probably benign	0.04
R6945:Lama1	UTSW	17	67813866	missense
R6984:Lama1	UTSW	17	67779112	missense
R6989:Lama1	UTSW	17	67753758	missense
R6994:Lama1	UTSW	17	67753825	missense
R6995:Lama1	UTSW	17	67753825	missense
R7035:Lama1	UTSW	17	67781049	missense
R7133:Lama1	UTSW	17	67782146	missense
R7172:Lama1	UTSW	17	67804545	missense
R7197:Lama1	UTSW	17	67737705	nonsense	probably null
R7217:Lama1	UTSW	17	67764673	missense
R7229:Lama1	UTSW	17	67752446	missense
R7264:Lama1	UTSW	17	67743297	missense
R7311:Lama1	UTSW	17	67767385	missense
R7394:Lama1	UTSW	17	67717261	missense
R7419:Lama1	UTSW	17	67717174	missense
R7460:Lama1	UTSW	17	67767018	missense
R7492:Lama1	UTSW	17	67817651	missense
R7494:Lama1	UTSW	17	67811446	missense
R7552:Lama1	UTSW	17	67737667	missense
R7576:Lama1	UTSW	17	67782041	missense
R7583:Lama1	UTSW	17	67761621	missense
R7649:Lama1	UTSW	17	67737554	missense
R7663:Lama1	UTSW	17	67780880	missense
R7667:Lama1	UTSW	17	67780597	missense
R7688:Lama1	UTSW	17	67761628	missense
R7693:Lama1	UTSW	17	67817031	missense
R7748:Lama1	UTSW	17	67750590	missense
R7778:Lama1	UTSW	17	67804473	missense
R7824:Lama1	UTSW	17	67804473	missense
R7861:Lama1	UTSW	17	67809221	missense
R7884:Lama1	UTSW	17	67769435	missense
R8029:Lama1	UTSW	17	67817594	missense
R8078:Lama1	UTSW	17	67791294	missense
R8101:Lama1	UTSW	17	67745922	missense
R8313:Lama1	UTSW	17	67750520	missense
R8356:Lama1	UTSW	17	67737496	missense
R8366:Lama1	UTSW	17	67818704	missense
R8403:Lama1	UTSW	17	67745923	missense
R8456:Lama1	UTSW	17	67737496	missense
R8466:Lama1	UTSW	17	67813953	missense
R8678:Lama1	UTSW	17	67817103	missense
R8728:Lama1	UTSW	17	67818668	missense
R8796:Lama1	UTSW	17	67810151	missense
R8885:Lama1	UTSW	17	67773784	missense
R8893:Lama1	UTSW	17	67805372	missense
R8898:Lama1	UTSW	17	67821615	missense
R8909:Lama1	UTSW	17	67772741	missense
R9025:Lama1	UTSW	17	67812496	missense
R9045:Lama1	UTSW	17	67753843	missense
R9098:Lama1	UTSW	17	67804513	missense
R9114:Lama1	UTSW	17	67821674	missense
R9173:Lama1	UTSW	17	67769602	missense
R9190:Lama1	UTSW	17	67804519	missense
R9381:Lama1	UTSW	17	67737484	missense
R9429:Lama1	UTSW	17	67811454	missense
R9504:Lama1	UTSW	17	67821666	missense
R9558:Lama1	UTSW	17	67817009	missense
R9647:Lama1	UTSW	17	67717175	missense
R9651:Lama1	UTSW	17	67794220	missense
R9654:Lama1	UTSW	17	67794271	missense
R9710:Lama1	UTSW	17	67822409	missense
R9733:Lama1	UTSW	17	67809945	missense
RF001:Lama1	UTSW	17	67752902	missense
RF013:Lama1	UTSW	17	67781062	missense
V8831:Lama1	UTSW	17	67752883	missense	probably benign	0.00
X0024:Lama1	UTSW	17	67738888	missense	probably damaging	1.00
X0028:Lama1	UTSW	17	67767422	missense	probably benign	0.00
X0028:Lama1	UTSW	17	67794310	missense	probably benign	0.06
X0066:Lama1	UTSW	17	67811566	missense	probably damaging	1.00
Z1088:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1088:Lama1	UTSW	17	67771082	missense	probably benign	0.25
Z1088:Lama1	UTSW	17	67810171	missense	probably damaging	1.00
Z1176:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1177:Lama1	UTSW	17	67752883	missense	probably benign	0.00
Z1191:Lama1	UTSW	17	67798644	missense

Predicted Primers

PCR Primer
(F):5'- CCAGGGCATTATCACTAAAGGACCG -3'
(R):5'- AAACATGGCCTTAGGCAGCCTC -3'

Sequencing Primer
(F):5'- GTTCACATGAGGAATTGCCACTG -3'
(R):5'- TTAGGCAGCCTCTCTAGCG -3'

Posted On

2013-05-23