Incidental Mutation 'R4897:Vwa3b'
ID375783
Institutional Source Beutler Lab
Gene Symbol Vwa3b
Ensembl Gene ENSMUSG00000050122
Gene Namevon Willebrand factor A domain containing 3B
Synonyms4921511C04Rik, A230074B11Rik
MMRRC Submission 042501-MU
Accession Numbers

NCBI RefSeq: XM_003084438.1; MGI:1918103

Is this an essential gene? Probably non essential (E-score: 0.054) question?
Stock #R4897 (G1)
Quality Score193
Status Validated
Chromosome1
Chromosomal Location37026596-37187613 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 37114603 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000027289 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027289]
AlphaFold A0A571BE33
Predicted Effect probably benign
Transcript: ENSMUST00000027289
SMART Domains Protein: ENSMUSP00000027289
Gene: ENSMUSG00000050122

DomainStartEndE-ValueType
Pfam:DUF4537 159 285 9.1e-36 PFAM
low complexity region 327 336 N/A INTRINSIC
low complexity region 345 364 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194048
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (79/79)
Allele List at MGI

All alleles(71) : Targeted(3) Gene trapped(68)

Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,376,297 M120I probably damaging Het
4933427D14Rik A T 11: 72,191,516 L328Q probably damaging Het
Adgrv1 A C 13: 81,561,585 probably null Het
Ankrd46 A T 15: 36,484,133 probably benign Het
Arhgef18 A T 8: 3,444,979 M413L probably benign Het
Atp6v1e1 G A 6: 120,804,083 T87M probably null Het
Bap1 T C 14: 31,258,445 probably benign Het
Brf1 A G 12: 112,965,887 L385P probably benign Het
C1qtnf1 A T 11: 118,448,112 N203Y probably damaging Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccnjl A C 11: 43,579,891 D162A probably damaging Het
Cd248 A C 19: 5,069,167 I348L probably benign Het
Cdc20 T C 4: 118,435,832 T265A probably benign Het
Cdca5 T A 19: 6,090,397 L196* probably null Het
Cdk4 T A 10: 127,064,575 probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Clec4b2 G T 6: 123,201,040 E105* probably null Het
Dapk1 T A 13: 60,761,786 D1404E probably benign Het
Dnah1 T C 14: 31,267,539 Y3308C probably damaging Het
Dnah17 A C 11: 118,078,593 Y2260D probably damaging Het
Dock8 T G 19: 25,181,637 S1720A probably benign Het
Erc1 A G 6: 119,777,986 probably null Het
Ergic1 A G 17: 26,629,623 I66V probably benign Het
Fam186a T C 15: 99,945,277 T1029A possibly damaging Het
Fat4 A T 3: 38,980,632 Y2811F probably damaging Het
Flt3 A G 5: 147,369,300 M310T probably damaging Het
Ganab T A 19: 8,914,991 C844S probably benign Het
Gas2l2 C A 11: 83,429,215 V72F probably damaging Het
Gm14401 T A 2: 177,086,780 C220S probably damaging Het
Gm9745 T G 13: 8,940,601 probably benign Het
Hmmr A T 11: 40,728,434 V73E probably benign Het
Ifih1 G T 2: 62,635,014 probably benign Het
Jak3 A G 8: 71,685,404 E833G probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Ldb1 G A 19: 46,034,693 A217V probably benign Het
Lrrc8c A G 5: 105,608,089 T577A probably benign Het
Mfn1 T A 3: 32,546,562 probably benign Het
Mki67 G A 7: 135,696,745 P2187S probably damaging Het
Mrc1 T A 2: 14,319,141 D1096E probably benign Het
Msi1 A G 5: 115,435,595 probably benign Het
Msto1 T A 3: 88,912,252 I152F probably benign Het
Myo9a A G 9: 59,896,517 R2060G probably benign Het
Nnt A T 13: 119,404,571 C44* probably null Het
Nup210l A G 3: 90,193,071 D1468G probably damaging Het
Olfr1176 C A 2: 88,344,342 C129F possibly damaging Het
Olfr1257 A G 2: 89,881,132 E102G probably benign Het
Olfr19 T C 16: 16,673,618 D121G probably damaging Het
Olfr345 T C 2: 36,640,894 L285P probably damaging Het
P2rx3 G A 2: 85,024,926 T62I probably damaging Het
Pabpc4l G T 3: 46,447,143 T22K probably damaging Het
Pcdha7 A G 18: 36,975,593 D557G probably damaging Het
Pcdhb20 A G 18: 37,506,245 K608R possibly damaging Het
Pcnx A G 12: 81,918,165 S369G probably damaging Het
Plod1 T C 4: 147,920,279 I455V probably benign Het
Prune2 A T 19: 17,121,855 E1574D probably benign Het
Ptar1 T A 19: 23,703,108 L96H probably damaging Het
Rabgap1 T C 2: 37,560,571 S904P probably benign Het
Rps6ka4 C T 19: 6,838,099 V176I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Runx1t1 T A 4: 13,771,459 M1K probably null Het
Serinc4 T A 2: 121,452,424 Y419F probably damaging Het
Serpina12 A T 12: 104,037,797 M192K possibly damaging Het
Spata21 T A 4: 141,104,950 M474K probably damaging Het
Stpg1 T C 4: 135,519,365 S135P possibly damaging Het
Tdrkh A G 3: 94,429,364 D481G probably damaging Het
Ube2e1 A C 14: 18,285,268 S68R probably damaging Het
Vcpip1 A C 1: 9,747,347 N270K probably damaging Het
Vmn2r79 T C 7: 87,001,467 F154L probably benign Het
Xdh C A 17: 73,900,708 V885L probably benign Het
Zfp141 A T 7: 42,476,205 V281D probably benign Het
Zfp317 T A 9: 19,646,847 I119N probably benign Het
Zfp345 G A 2: 150,472,688 R310C probably benign Het
Zfp760 G A 17: 21,723,248 C468Y probably benign Het
Other mutations in Vwa3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01404:Vwa3b APN 1 37154036 missense probably benign 0.28
IGL02236:Vwa3b APN 1 37154051 splice site probably benign
IGL02653:Vwa3b APN 1 37175565 utr 3 prime probably benign
IGL02823:Vwa3b APN 1 37186904 utr 3 prime probably benign
IGL03030:Vwa3b APN 1 37044968 missense probably damaging 1.00
P0014:Vwa3b UTSW 1 37173914 utr 3 prime probably benign
R0035:Vwa3b UTSW 1 37165689 missense possibly damaging 0.69
R0102:Vwa3b UTSW 1 37135514 missense probably damaging 1.00
R0556:Vwa3b UTSW 1 37164485 splice site probably benign
R1061:Vwa3b UTSW 1 37157430 missense probably damaging 1.00
R1386:Vwa3b UTSW 1 37051881 critical splice donor site probably null
R2441:Vwa3b UTSW 1 37143069 unclassified probably benign
R3117:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R3119:Vwa3b UTSW 1 37109077 missense possibly damaging 0.95
R4081:Vwa3b UTSW 1 37035824 missense probably damaging 0.99
R4393:Vwa3b UTSW 1 37045178 missense probably damaging 1.00
R4950:Vwa3b UTSW 1 37085332 missense probably benign 0.00
R4978:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5141:Vwa3b UTSW 1 37187021 utr 3 prime probably benign
R5286:Vwa3b UTSW 1 37045039 missense probably damaging 1.00
R5356:Vwa3b UTSW 1 37114583 missense probably damaging 0.99
R5426:Vwa3b UTSW 1 37115671 missense probably damaging 0.99
R5480:Vwa3b UTSW 1 37100706 nonsense probably null
R5727:Vwa3b UTSW 1 37135519 missense probably benign 0.10
R5876:Vwa3b UTSW 1 37076439 missense probably damaging 0.97
R6191:Vwa3b UTSW 1 37114531 missense possibly damaging 0.92
R6219:Vwa3b UTSW 1 37100698 missense possibly damaging 0.92
R6250:Vwa3b UTSW 1 37051885 splice site probably null
R6281:Vwa3b UTSW 1 37123982 missense probably damaging 1.00
R6419:Vwa3b UTSW 1 37157376 missense probably benign 0.01
R6467:Vwa3b UTSW 1 37085286 missense probably benign 0.01
R6512:Vwa3b UTSW 1 37063642 intron probably benign
R6541:Vwa3b UTSW 1 37051761 missense probably damaging 1.00
R6724:Vwa3b UTSW 1 37045031 missense probably damaging 1.00
R6728:Vwa3b UTSW 1 37157372 missense probably damaging 1.00
R7046:Vwa3b UTSW 1 37173878 missense probably benign
R7117:Vwa3b UTSW 1 37135553 missense
R7304:Vwa3b UTSW 1 37164505 missense probably damaging 1.00
R7402:Vwa3b UTSW 1 37114597 nonsense probably null
R7762:Vwa3b UTSW 1 37124045 missense probably damaging 1.00
R7911:Vwa3b UTSW 1 37154026 missense probably damaging 1.00
R8213:Vwa3b UTSW 1 37128939 missense probably benign 0.07
R8402:Vwa3b UTSW 1 37165798 missense probably damaging 1.00
R8697:Vwa3b UTSW 1 37076380 missense probably benign 0.09
R8758:Vwa3b UTSW 1 37137792 missense
R8874:Vwa3b UTSW 1 37035758 missense possibly damaging 0.73
R9011:Vwa3b UTSW 1 37115686 missense probably damaging 1.00
R9012:Vwa3b UTSW 1 37085310 missense probably benign 0.15
R9015:Vwa3b UTSW 1 37164516 missense possibly damaging 0.71
R9102:Vwa3b UTSW 1 37135512 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- ACAGACTCTGTTTACTATGATGCC -3'
(R):5'- GGGCCAGTTCACACAGTTTC -3'

Sequencing Primer
(F):5'- ATGATGCCTTTTTCCTGTCTAGG -3'
(R):5'- GCCAGTTCACACAGTTTCACTAATTG -3'
Posted On2016-03-17