Mutagenetix > Incidental Mutation

Incidental Mutation 'R0281:Svil'

37579

Institutional Source

Beutler Lab

Gene Symbol

Svil

Ensembl Gene

ENSMUSG00000024236

Gene Name

supervillin

Synonyms

B430302E16Rik

MMRRC Submission

038503-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.193) question?

Stock #

R0281 (G1)

Quality Score

149

Status

Validated

Chromosome

Chromosomal Location

4920540-5119299 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 5094582 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 1421 (S1421P)

Ref Sequence

ENSEMBL: ENSMUSP00000122242 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025079] [ENSMUST00000126977] [ENSMUST00000127297] [ENSMUST00000131609] [ENSMUST00000140448] [ENSMUST00000143254] [ENSMUST00000210707]

AlphaFold

Q8K4L3

Predicted Effect

probably damaging
Transcript: ENSMUST00000025079
AA Change: S1421P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000025079
Gene: ENSMUSG00000024236
AA Change: S1421P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000125512
AA Change: S407P

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000121972
Gene: ENSMUSG00000024236
AA Change: S407P

Domain	Start	End	E-Value	Type
low complexity region	168	178	N/A	INTRINSIC
GEL	384	483	4.58e-22	SMART
GEL	508	625	4.03e-1	SMART
Blast:GEL	695	733	1e-18	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000126977
AA Change: S1421P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000115078
Gene: ENSMUSG00000024236
AA Change: S1421P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000127297
AA Change: S1307P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000115223
Gene: ENSMUSG00000024236
AA Change: S1307P

Domain	Start	End	E-Value	Type
low complexity region	1067	1077	N/A	INTRINSIC
GEL	1283	1382	4.58e-22	SMART
GEL	1407	1524	4.03e-1	SMART
GEL	1594	1704	2.93e-20	SMART
low complexity region	1711	1717	N/A	INTRINSIC
GEL	1723	1824	1.72e-17	SMART
GEL	1857	1964	1.37e0	SMART
VHP	2021	2056	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000131609
AA Change: S1421P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000122242
Gene: ENSMUSG00000024236
AA Change: S1421P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	2.9e-24	SMART
GEL	1521	1638	2.5e-3	SMART
GEL	1708	1818	1.9e-22	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.1e-19	SMART
low complexity region	1965	1974	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000139761

Predicted Effect

probably damaging
Transcript: ENSMUST00000140448
AA Change: S1421P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000119803
Gene: ENSMUSG00000024236
AA Change: S1421P

Domain	Start	End	E-Value	Type
low complexity region	1181	1191	N/A	INTRINSIC
GEL	1397	1496	4.58e-22	SMART
GEL	1521	1638	4.03e-1	SMART
GEL	1708	1818	2.93e-20	SMART
low complexity region	1825	1831	N/A	INTRINSIC
GEL	1837	1938	1.72e-17	SMART
GEL	1971	2078	1.37e0	SMART
VHP	2135	2170	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000143254
AA Change: S1017P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000119287
Gene: ENSMUSG00000024236
AA Change: S1017P

Domain	Start	End	E-Value	Type
low complexity region	777	787	N/A	INTRINSIC
GEL	993	1092	4.58e-22	SMART
GEL	1117	1234	4.03e-1	SMART
GEL	1304	1414	2.93e-20	SMART
low complexity region	1421	1427	N/A	INTRINSIC
GEL	1433	1534	1.72e-17	SMART
GEL	1567	1674	1.37e0	SMART
VHP	1731	1766	1.15e-18	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000210707
AA Change: S1508P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (104/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a bipartite protein with distinct amino- and carboxy-terminal domains. The amino-terminus contains nuclear localization signals and the carboxy-terminus contains numerous consecutive sequences with extensive similarity to proteins in the gelsolin family of actin-binding proteins, which cap, nucleate, and/or sever actin filaments. The gene product is tightly associated with both actin filaments and plasma membranes, suggesting a role as a high-affinity link between the actin cytoskeleton and the membrane. The encoded protein appears to aid in both myosin II assembly during cell spreading and disassembly of focal adhesions. Several transcript variants encoding different isoforms of supervillin have been described. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit enhanched adhesion and thrombus formation. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2610507B11Rik	C	T	11: 78,271,924	L871F	possibly damaging	Het
4933430I17Rik	A	T	4: 62,546,067	R374*	probably null	Het
5930422O12Rik	A	T	8: 33,429,379	R76*	probably null	Het
A1cf	G	A	19: 31,945,814	A505T	probably benign	Het
Abcc5	T	A	16: 20,422,400	I12F	probably damaging	Het
Abcf2	T	C	5: 24,566,564	E555G	probably damaging	Het
Acan	A	T	7: 79,100,285	E1601D	probably damaging	Het
Adam2	T	A	14: 66,037,606	K559N	probably benign	Het
Akap11	A	C	14: 78,510,089	D1619E	possibly damaging	Het
Ankrd11	T	C	8: 122,895,568	D515G	probably benign	Het
Ankrd27	T	A	7: 35,619,371	N562K	probably damaging	Het
Atp10b	T	C	11: 43,153,304	I119T	probably benign	Het
Atr	T	C	9: 95,937,566	I2202T	probably benign	Het
BC067074	A	T	13: 113,369,143	I727F	probably damaging	Het
Brd4	T	A	17: 32,213,540		probably benign	Het
Catsperg2	C	T	7: 29,706,571	C634Y	possibly damaging	Het
Cep192	A	G	18: 67,828,482		probably benign	Het
Cfap65	T	A	1: 74,927,071	I366F	probably damaging	Het
Cnga4	G	T	7: 105,407,668	R326L	probably damaging	Het
Cntnap5b	T	A	1: 100,072,153	M212K	probably benign	Het
Col6a6	T	A	9: 105,784,116	M265L	probably benign	Het
Cyp26b1	A	T	6: 84,574,556	F417Y	probably damaging	Het
Dhx15	A	T	5: 52,150,746	M768K	probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Duox2	C	T	2: 122,292,304	V550M	probably benign	Het
Elmo2	A	G	2: 165,296,890	L456P	probably damaging	Het
Fbxo39	T	C	11: 72,317,530	I236T	probably benign	Het
Fezf2	A	G	14: 12,343,977	C305R	probably damaging	Het
Fndc3b	C	A	3: 27,457,006	C785F	probably benign	Het
Gm12253	T	C	11: 58,440,012		probably benign	Het
Gnat2	T	A	3: 108,095,562	Y95*	probably null	Het
Gopc	T	C	10: 52,350,678	K220E	probably damaging	Het
Hectd4	G	A	5: 121,254,251	D193N	possibly damaging	Het
Hexa	G	A	9: 59,554,226		probably null	Het
Hspa4l	T	C	3: 40,785,408		probably benign	Het
Hspa5	T	C	2: 34,774,320	S301P	probably damaging	Het
Ice1	A	T	13: 70,604,047	S1307T	possibly damaging	Het
Igtp	T	C	11: 58,206,054	L17P	probably damaging	Het
Itk	T	C	11: 46,353,916	Y225C	probably damaging	Het
Kifc3	A	G	8: 95,103,460	V560A	probably damaging	Het
Lama1	A	G	17: 67,817,569	N2875D	probably damaging	Het
Lasp1	C	A	11: 97,806,851	C32*	probably null	Het
Lcp2	T	A	11: 34,069,854		probably benign	Het
Lhx9	C	T	1: 138,832,904	G236D	probably benign	Het
Lrrc38	A	T	4: 143,350,409	I81F	probably damaging	Het
Ly6a	C	T	15: 74,995,387	V94M	probably benign	Het
Map3k13	A	G	16: 21,914,157	E503G	probably damaging	Het
Mertk	T	C	2: 128,782,621		probably benign	Het
Mkl2	T	A	16: 13,412,163	I915N	probably damaging	Het
Msantd2	G	A	9: 37,523,219	D252N	possibly damaging	Het
Mtmr12	T	A	15: 12,257,706	L290*	probably null	Het
Myo3a	T	C	2: 22,245,598	I92T	probably benign	Het
Naglu	T	A	11: 101,074,027	N313K	probably damaging	Het
Nceh1	T	C	3: 27,222,804	V92A	possibly damaging	Het
Ncf4	A	G	15: 78,250,883	T47A	probably damaging	Het
Nrp1	T	A	8: 128,460,683	F403L	probably damaging	Het
Nxph3	T	C	11: 95,511,256	T111A	possibly damaging	Het
Obscn	T	A	11: 59,038,615	E6061V	probably damaging	Het
Obsl1	C	A	1: 75,492,927	G1149W	probably damaging	Het
Olfr1162	C	T	2: 88,050,412	V71I	possibly damaging	Het
Olfr1370	T	A	13: 21,072,374	Y309F	probably benign	Het
Olfr1487	A	G	19: 13,619,485	T65A	probably benign	Het
Olfr267	A	T	4: 58,784,981	V247E	probably damaging	Het
Olfr292	A	G	7: 86,694,860	T135A	probably benign	Het
Olfr493	A	C	7: 108,346,914	D22E	probably benign	Het
Olfr814	T	A	10: 129,874,546	L70F	possibly damaging	Het
Pde9a	T	C	17: 31,455,106	V55A	probably damaging	Het
Pip4k2c	A	T	10: 127,205,821		probably null	Het
Plvap	T	C	8: 71,511,382	N112S	probably damaging	Het
Pop1	T	A	15: 34,529,858		probably null	Het
Ppip5k2	T	C	1: 97,716,553	H1113R	possibly damaging	Het
Ptprk	A	T	10: 28,573,392	I962F	probably damaging	Het
Rad51ap2	T	C	12: 11,457,042	S322P	possibly damaging	Het
Rasal1	A	G	5: 120,674,605	T565A	probably benign	Het
Rbm15	C	A	3: 107,331,155	R642S	probably damaging	Het
Rpsa	G	A	9: 120,131,003	E211K	possibly damaging	Het
Ryr3	A	G	2: 112,686,810	S3303P	probably damaging	Het
Scg2	T	A	1: 79,435,512	N458I	possibly damaging	Het
Setx	A	G	2: 29,179,643	T2487A	probably benign	Het
Slc4a5	G	A	6: 83,267,567		probably benign	Het
Slc8a2	T	A	7: 16,140,989	D387E	probably benign	Het
Smarcc2	A	G	10: 128,474,722	T407A	probably benign	Het
Snap25	A	G	2: 136,777,464	D179G	probably damaging	Het
Socs4	T	C	14: 47,289,868	S74P	probably benign	Het
Sp6	T	A	11: 97,021,925	Y155N	probably benign	Het
Srrt	C	T	5: 137,296,127		probably benign	Het
Steap1	C	T	5: 5,736,431	M335I	probably benign	Het
Stra6	A	T	9: 58,145,489	Y250F	probably benign	Het
Tcea3	G	A	4: 136,271,366	C317Y	probably damaging	Het
Tmco6	T	C	18: 36,737,704	L117S	probably damaging	Het
Trp53bp1	T	C	2: 121,270,237	K89E	probably damaging	Het
Trp63	T	A	16: 25,764,302		probably benign	Het
Ube2d2a	A	G	18: 35,800,132	Y74C	probably damaging	Het
Usp19	T	G	9: 108,498,509	F885V	probably damaging	Het
Utp18	T	A	11: 93,882,177		probably benign	Het
Vmn2r116	T	C	17: 23,401,413	I707T	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Zfp318	C	T	17: 46,412,614	P1848S	probably benign	Het
Zfp984	G	T	4: 147,755,265	N376K	probably benign	Het

Other mutations in Svil

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Svil	APN	18	5099045	missense	probably benign	0.27
IGL00840:Svil	APN	18	5063555	missense	probably benign
IGL01329:Svil	APN	18	5064501	missense	probably benign
IGL01446:Svil	APN	18	5062385	missense	probably damaging	1.00
IGL02068:Svil	APN	18	5092899	missense	probably damaging	1.00
IGL02223:Svil	APN	18	5105879	splice site	probably benign
IGL02428:Svil	APN	18	5118203	missense	probably damaging	1.00
IGL02429:Svil	APN	18	5118369	missense	probably benign	0.00
IGL02479:Svil	APN	18	5099476	missense	probably damaging	1.00
IGL02560:Svil	APN	18	5049379	missense	probably benign	0.00
IGL02652:Svil	APN	18	5114531	missense	probably damaging	1.00
IGL03291:Svil	APN	18	5056150	nonsense	probably null
R3779_Svil_985	UTSW	18	5090855	missense	probably damaging	0.97
R5433_Svil_176	UTSW	18	5059294	missense	probably damaging	0.99
R6062_Svil_873	UTSW	18	5106724	missense	probably damaging	1.00
BB002:Svil	UTSW	18	5118357	missense	probably benign	0.00
BB012:Svil	UTSW	18	5118357	missense	probably benign	0.00
IGL03055:Svil	UTSW	18	5108615	missense	probably damaging	1.00
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0029:Svil	UTSW	18	5063286	missense	probably benign	0.14
R0266:Svil	UTSW	18	5099063	splice site	probably benign
R0442:Svil	UTSW	18	5046870	missense	probably damaging	1.00
R0549:Svil	UTSW	18	5064566	missense	possibly damaging	0.79
R0617:Svil	UTSW	18	5117002	missense	probably damaging	1.00
R0801:Svil	UTSW	18	5099443	missense	probably benign	0.00
R0894:Svil	UTSW	18	5097494	missense	probably damaging	1.00
R1053:Svil	UTSW	18	5056690	missense	probably benign	0.16
R1065:Svil	UTSW	18	5063777	splice site	probably benign
R1080:Svil	UTSW	18	5058147	missense	possibly damaging	0.79
R1199:Svil	UTSW	18	5059217	splice site	probably benign
R1472:Svil	UTSW	18	5048950	missense	probably benign	0.09
R1480:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R1544:Svil	UTSW	18	5046817	missense	possibly damaging	0.93
R1626:Svil	UTSW	18	5117099	critical splice donor site	probably null
R1691:Svil	UTSW	18	5056336	missense	probably benign	0.06
R1812:Svil	UTSW	18	5097545	missense	probably damaging	1.00
R1826:Svil	UTSW	18	5063383	missense	probably benign	0.01
R1842:Svil	UTSW	18	5062373	missense	probably damaging	1.00
R1884:Svil	UTSW	18	5094640	missense	possibly damaging	0.94
R1945:Svil	UTSW	18	5117059	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099534	missense	probably damaging	1.00
R2184:Svil	UTSW	18	5099615	missense	probably damaging	1.00
R2232:Svil	UTSW	18	5046640	start codon destroyed	probably null	0.98
R2398:Svil	UTSW	18	5060613	splice site	probably null
R3076:Svil	UTSW	18	5116055	missense	probably damaging	1.00
R3777:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3779:Svil	UTSW	18	5090855	missense	probably damaging	0.97
R3797:Svil	UTSW	18	5060534	missense	probably benign	0.29
R4077:Svil	UTSW	18	5063522	missense	probably benign	0.03
R4350:Svil	UTSW	18	5118154	missense	probably damaging	1.00
R4379:Svil	UTSW	18	5046909	missense	probably damaging	1.00
R4488:Svil	UTSW	18	5049067	missense	probably damaging	1.00
R4777:Svil	UTSW	18	5088813	missense	probably damaging	0.99
R4825:Svil	UTSW	18	5114564	missense	probably damaging	1.00
R4921:Svil	UTSW	18	5108631	missense	probably damaging	1.00
R4969:Svil	UTSW	18	5095516	missense	probably damaging	1.00
R4975:Svil	UTSW	18	5054025	missense	possibly damaging	0.61
R4990:Svil	UTSW	18	5056810	missense	probably benign	0.05
R4991:Svil	UTSW	18	5056810	missense	probably benign	0.05
R5061:Svil	UTSW	18	5048954	missense	probably benign	0.02
R5271:Svil	UTSW	18	5062329	missense	probably benign	0.45
R5362:Svil	UTSW	18	5057345	missense	probably damaging	1.00
R5433:Svil	UTSW	18	5059294	missense	probably damaging	0.99
R5677:Svil	UTSW	18	5046823	nonsense	probably null
R5850:Svil	UTSW	18	5098900	splice site	probably null
R5868:Svil	UTSW	18	5056854	splice site	probably null
R5871:Svil	UTSW	18	5103669	splice site	probably null
R5876:Svil	UTSW	18	5082828	missense	probably damaging	1.00
R6061:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6062:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6063:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6065:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6066:Svil	UTSW	18	5106724	missense	probably damaging	1.00
R6114:Svil	UTSW	18	5108639	missense	probably damaging	1.00
R6115:Svil	UTSW	18	5108675	missense	probably damaging	0.99
R6117:Svil	UTSW	18	5116016	missense	probably damaging	1.00
R6302:Svil	UTSW	18	5057432	missense	probably benign	0.13
R6418:Svil	UTSW	18	5040171	missense	probably benign	0.26
R6441:Svil	UTSW	18	5049323	missense	probably benign
R6446:Svil	UTSW	18	5057323	missense	probably benign	0.09
R6455:Svil	UTSW	18	5056629	missense	possibly damaging	0.89
R6545:Svil	UTSW	18	5108621	missense	probably benign	0.00
R6692:Svil	UTSW	18	5082853	missense	probably damaging	1.00
R6730:Svil	UTSW	18	5049311	missense	probably benign	0.17
R6763:Svil	UTSW	18	5056437	missense	probably damaging	0.99
R6870:Svil	UTSW	18	5063231	missense	possibly damaging	0.86
R6916:Svil	UTSW	18	5114682	utr 3 prime	probably benign
R7134:Svil	UTSW	18	5116080	missense	probably damaging	1.00
R7190:Svil	UTSW	18	5092937	missense	probably benign	0.01
R7213:Svil	UTSW	18	5094574	missense	probably damaging	0.99
R7249:Svil	UTSW	18	5056270	missense	probably benign	0.01
R7249:Svil	UTSW	18	5062247	missense	probably damaging	0.99
R7421:Svil	UTSW	18	5056109	missense	probably benign	0.18
R7571:Svil	UTSW	18	5114636	missense	probably damaging	1.00
R7574:Svil	UTSW	18	5095188	missense	probably benign	0.16
R7645:Svil	UTSW	18	5099663	missense	probably damaging	1.00
R7925:Svil	UTSW	18	5118357	missense	probably benign	0.00
R8113:Svil	UTSW	18	5062385	missense	probably damaging	1.00
R8263:Svil	UTSW	18	5108679	missense	probably damaging	1.00
R8485:Svil	UTSW	18	5064566	missense	probably benign	0.03
R8491:Svil	UTSW	18	5106678	missense	probably damaging	1.00
R8752:Svil	UTSW	18	5060366	intron	probably benign
R8774:Svil	UTSW	18	5049068	missense	probably damaging	1.00
R8774-TAIL:Svil	UTSW	18	5049068	missense	probably damaging	1.00
R8780:Svil	UTSW	18	5063449	missense	probably benign	0.00
R8787:Svil	UTSW	18	5059332	nonsense	probably null
R8790:Svil	UTSW	18	5056098	missense	possibly damaging	0.82
R8974:Svil	UTSW	18	5099650	missense	probably damaging	1.00
R9029:Svil	UTSW	18	5056239	missense	probably benign
R9072:Svil	UTSW	18	5097500	missense	probably benign	0.23
R9073:Svil	UTSW	18	5097500	missense	probably benign	0.23
R9079:Svil	UTSW	18	5056308	missense	probably benign	0.31
R9181:Svil	UTSW	18	5090833	missense	possibly damaging	0.75
R9363:Svil	UTSW	18	5037155	missense	probably benign	0.02
R9377:Svil	UTSW	18	5057294	missense	probably benign	0.06
R9381:Svil	UTSW	18	5099013	missense	probably benign	0.06
R9389:Svil	UTSW	18	5090811	missense	possibly damaging	0.52
R9566:Svil	UTSW	18	5099661	missense	probably damaging	1.00
R9607:Svil	UTSW	18	5058126	missense	possibly damaging	0.92
R9716:Svil	UTSW	18	5062370	missense	probably damaging	1.00
R9801:Svil	UTSW	18	5049062	missense	probably damaging	1.00
X0065:Svil	UTSW	18	5062317	missense	probably damaging	1.00
Z1177:Svil	UTSW	18	5062344	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCCACTCTTCCAAGACTGGAGAAC -3'
(R):5'- AGCTAAGACCCAGGGCTTTCAAAC -3'

Sequencing Primer
(F):5'- TGGAGAACCTTGGCACATC -3'
(R):5'- GGCTTTCAAACTGGAGATGC -3'

Posted On

2013-05-23