Incidental Mutation 'R4897:Runx1t1'
ID375803
Institutional Source Beutler Lab
Gene Symbol Runx1t1
Ensembl Gene ENSMUSG00000006586
Gene Namerunt-related transcription factor 1; translocated to, 1 (cyclin D-related)
SynonymsCbfa2t1h, ETO, MTG8
MMRRC Submission 042501-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.847) question?
Stock #R4897 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location13743436-13893649 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to A at 13771459 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 1 (M1K)
Ref Sequence ENSEMBL: ENSMUSP00000127109 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006761] [ENSMUST00000098257] [ENSMUST00000105566]
Predicted Effect probably benign
Transcript: ENSMUST00000006761
SMART Domains Protein: ENSMUSP00000006761
Gene: ENSMUSG00000006586

DomainStartEndE-ValueType
low complexity region 32 48 N/A INTRINSIC
low complexity region 68 96 N/A INTRINSIC
TAFH 102 192 1.12e-53 SMART
low complexity region 266 277 N/A INTRINSIC
Pfam:NHR2 317 383 6.9e-42 PFAM
SCOP:d1gpua1 384 454 7e-3 SMART
PDB:2KYG|C 417 447 2e-12 PDB
Pfam:zf-MYND 495 531 4e-10 PFAM
low complexity region 543 558 N/A INTRINSIC
low complexity region 562 583 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000098257
AA Change: M1K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000095857
Gene: ENSMUSG00000006586
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
TAFH 122 212 1.12e-53 SMART
low complexity region 286 297 N/A INTRINSIC
Pfam:NHR2 337 403 5.2e-43 PFAM
SCOP:d1gpua1 404 474 7e-3 SMART
PDB:2KYG|C 437 467 2e-12 PDB
Pfam:zf-MYND 515 551 6.7e-10 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 582 603 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000105566
AA Change: M1K

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000127109
Gene: ENSMUSG00000006586
AA Change: M1K

DomainStartEndE-ValueType
low complexity region 52 68 N/A INTRINSIC
low complexity region 88 116 N/A INTRINSIC
TAFH 122 212 1.12e-53 SMART
low complexity region 286 297 N/A INTRINSIC
Pfam:NHR2 337 403 3.6e-42 PFAM
SCOP:d1gpua1 404 474 7e-3 SMART
PDB:2KYG|C 437 467 2e-12 PDB
Pfam:zf-MYND 515 551 1.4e-10 PFAM
low complexity region 563 578 N/A INTRINSIC
low complexity region 582 603 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150583
Meta Mutation Damage Score 0.9523 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the myeloid translocation gene family which interact with DNA-bound transcription factors and recruit a range of corepressors to facilitate transcriptional repression. The t(8;21)(q22;q22) translocation is one of the most frequent karyotypic abnormalities in acute myeloid leukemia. The translocation produces a chimeric gene made up of the 5'-region of the runt-related transcription factor 1 gene fused to the 3'-region of this gene. The chimeric protein is thought to associate with the nuclear corepressor/histone deacetylase complex to block hematopoietic differentiation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous disruption of this gene results in increased perinatal lethality and surviving animals show severe growth retardation. The midgut is absent in 25% of mutant animals which could explain increased perinatal mortality. Surviving animals display thinned intestinal walls and dilated lumens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,376,297 M120I probably damaging Het
4933427D14Rik A T 11: 72,191,516 L328Q probably damaging Het
Adgrv1 A C 13: 81,561,585 probably null Het
Ankrd46 A T 15: 36,484,133 probably benign Het
Arhgef18 A T 8: 3,444,979 M413L probably benign Het
Atp6v1e1 G A 6: 120,804,083 T87M probably null Het
Bap1 T C 14: 31,258,445 probably benign Het
Brf1 A G 12: 112,965,887 L385P probably benign Het
C1qtnf1 A T 11: 118,448,112 N203Y probably damaging Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccnjl A C 11: 43,579,891 D162A probably damaging Het
Cd248 A C 19: 5,069,167 I348L probably benign Het
Cdc20 T C 4: 118,435,832 T265A probably benign Het
Cdca5 T A 19: 6,090,397 L196* probably null Het
Cdk4 T A 10: 127,064,575 probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Clec4b2 G T 6: 123,201,040 E105* probably null Het
Dapk1 T A 13: 60,761,786 D1404E probably benign Het
Dnah1 T C 14: 31,267,539 Y3308C probably damaging Het
Dnah17 A C 11: 118,078,593 Y2260D probably damaging Het
Dock8 T G 19: 25,181,637 S1720A probably benign Het
Erc1 A G 6: 119,777,986 probably null Het
Ergic1 A G 17: 26,629,623 I66V probably benign Het
Fam186a T C 15: 99,945,277 T1029A possibly damaging Het
Fat4 A T 3: 38,980,632 Y2811F probably damaging Het
Flt3 A G 5: 147,369,300 M310T probably damaging Het
Ganab T A 19: 8,914,991 C844S probably benign Het
Gas2l2 C A 11: 83,429,215 V72F probably damaging Het
Gm14401 T A 2: 177,086,780 C220S probably damaging Het
Gm9745 T G 13: 8,940,601 probably benign Het
Hmmr A T 11: 40,728,434 V73E probably benign Het
Ifih1 G T 2: 62,635,014 probably benign Het
Jak3 A G 8: 71,685,404 E833G probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Ldb1 G A 19: 46,034,693 A217V probably benign Het
Lrrc8c A G 5: 105,608,089 T577A probably benign Het
Mfn1 T A 3: 32,546,562 probably benign Het
Mki67 G A 7: 135,696,745 P2187S probably damaging Het
Mrc1 T A 2: 14,319,141 D1096E probably benign Het
Msi1 A G 5: 115,435,595 probably benign Het
Msto1 T A 3: 88,912,252 I152F probably benign Het
Myo9a A G 9: 59,896,517 R2060G probably benign Het
Nnt A T 13: 119,404,571 C44* probably null Het
Nup210l A G 3: 90,193,071 D1468G probably damaging Het
Olfr1176 C A 2: 88,344,342 C129F possibly damaging Het
Olfr1257 A G 2: 89,881,132 E102G probably benign Het
Olfr19 T C 16: 16,673,618 D121G probably damaging Het
Olfr345 T C 2: 36,640,894 L285P probably damaging Het
P2rx3 G A 2: 85,024,926 T62I probably damaging Het
Pabpc4l G T 3: 46,447,143 T22K probably damaging Het
Pcdha7 A G 18: 36,975,593 D557G probably damaging Het
Pcdhb20 A G 18: 37,506,245 K608R possibly damaging Het
Pcnx A G 12: 81,918,165 S369G probably damaging Het
Plod1 T C 4: 147,920,279 I455V probably benign Het
Prune2 A T 19: 17,121,855 E1574D probably benign Het
Ptar1 T A 19: 23,703,108 L96H probably damaging Het
Rabgap1 T C 2: 37,560,571 S904P probably benign Het
Rps6ka4 C T 19: 6,838,099 V176I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Serinc4 T A 2: 121,452,424 Y419F probably damaging Het
Serpina12 A T 12: 104,037,797 M192K possibly damaging Het
Spata21 T A 4: 141,104,950 M474K probably damaging Het
Stpg1 T C 4: 135,519,365 S135P possibly damaging Het
Tdrkh A G 3: 94,429,364 D481G probably damaging Het
Ube2e1 A C 14: 18,285,268 S68R probably damaging Het
Vcpip1 A C 1: 9,747,347 N270K probably damaging Het
Vmn2r79 T C 7: 87,001,467 F154L probably benign Het
Vwa3b A G 1: 37,114,603 probably benign Het
Xdh C A 17: 73,900,708 V885L probably benign Het
Zfp141 A T 7: 42,476,205 V281D probably benign Het
Zfp317 T A 9: 19,646,847 I119N probably benign Het
Zfp345 G A 2: 150,472,688 R310C probably benign Het
Zfp760 G A 17: 21,723,248 C468Y probably benign Het
Other mutations in Runx1t1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Runx1t1 APN 4 13835663 missense probably benign 0.07
IGL01600:Runx1t1 APN 4 13841871 missense probably damaging 1.00
IGL02120:Runx1t1 APN 4 13846884 missense probably benign
IGL02172:Runx1t1 APN 4 13859924 missense probably benign 0.00
IGL02429:Runx1t1 APN 4 13865294 splice site probably benign
IGL02730:Runx1t1 APN 4 13860019 missense probably benign 0.01
IGL02870:Runx1t1 APN 4 13889867 missense unknown
IGL02879:Runx1t1 APN 4 13889868 missense unknown
IGL03369:Runx1t1 APN 4 13881107 missense probably damaging 1.00
IGL03047:Runx1t1 UTSW 4 13865882 missense probably damaging 1.00
R1832:Runx1t1 UTSW 4 13835628 splice site probably benign
R1884:Runx1t1 UTSW 4 13835767 missense probably benign 0.00
R2277:Runx1t1 UTSW 4 13771501 missense probably benign 0.00
R4059:Runx1t1 UTSW 4 13889769 missense probably benign 0.33
R4505:Runx1t1 UTSW 4 13889676 missense probably damaging 1.00
R4585:Runx1t1 UTSW 4 13889864 missense unknown
R4586:Runx1t1 UTSW 4 13889864 missense unknown
R4758:Runx1t1 UTSW 4 13865907 missense probably damaging 1.00
R4795:Runx1t1 UTSW 4 13837767 missense probably damaging 0.99
R4796:Runx1t1 UTSW 4 13837767 missense probably damaging 0.99
R4971:Runx1t1 UTSW 4 13837978 missense probably damaging 1.00
R5009:Runx1t1 UTSW 4 13865231 missense possibly damaging 0.80
R5091:Runx1t1 UTSW 4 13846830 nonsense probably null
R5844:Runx1t1 UTSW 4 13881068 missense probably damaging 1.00
R5968:Runx1t1 UTSW 4 13841890 splice site probably null
R5993:Runx1t1 UTSW 4 13875490 missense probably benign 0.00
R5993:Runx1t1 UTSW 4 13841863 missense probably damaging 0.98
R6329:Runx1t1 UTSW 4 13785136 start codon destroyed probably null 0.38
R6915:Runx1t1 UTSW 4 13865257 missense probably damaging 0.99
R7283:Runx1t1 UTSW 4 13846935 missense probably damaging 1.00
Z1088:Runx1t1 UTSW 4 13865892 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- CACAGAGCTGGTCTAGTTTATCATG -3'
(R):5'- TTAAGCAGAATTCGCACAGGC -3'

Sequencing Primer
(F):5'- TCATGTAAATAGATGGGAAGGATGC -3'
(R):5'- AGAATTCGCACAGGCTGGTC -3'
Posted On2016-03-17