Incidental Mutation 'R4897:Arhgef18'
ID375817
Institutional Source Beutler Lab
Gene Symbol Arhgef18
Ensembl Gene ENSMUSG00000004568
Gene Namerho/rac guanine nucleotide exchange factor (GEF) 18
SynonymsD030053O22Rik
MMRRC Submission 042501-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4897 (G1)
Quality Score190
Status Validated
Chromosome8
Chromosomal Location3393006-3456601 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3444979 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Leucine at position 413 (M413L)
Ref Sequence ENSEMBL: ENSMUSP00000004684 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004684]
Predicted Effect probably benign
Transcript: ENSMUST00000004684
AA Change: M413L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004684
Gene: ENSMUSG00000004568
AA Change: M413L

DomainStartEndE-ValueType
RhoGEF 105 297 2.62e-58 SMART
PH 340 443 5.57e-12 SMART
low complexity region 446 456 N/A INTRINSIC
low complexity region 646 663 N/A INTRINSIC
coiled coil region 697 800 N/A INTRINSIC
low complexity region 887 897 N/A INTRINSIC
low complexity region 905 919 N/A INTRINSIC
low complexity region 963 985 N/A INTRINSIC
low complexity region 991 1010 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131773
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156085
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Rho GTPases are GTP binding proteins that regulate a wide spectrum of cellular functions. These cellular processes include cytoskeletal rearrangements, gene transcription, cell growth and motility. Activation of Rho GTPases is under the direct control of guanine nucleotide exchange factors (GEFs). The protein encoded by this gene is a guanine nucleotide exchange factor and belongs to the Rho GTPase GFE family. Family members share a common feature, a Dbl (DH) homology domain followed by a pleckstrin (PH) homology domain. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit greatly reduced viability. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,376,297 M120I probably damaging Het
4933427D14Rik A T 11: 72,191,516 L328Q probably damaging Het
Adgrv1 A C 13: 81,561,585 probably null Het
Ankrd46 A T 15: 36,484,133 probably benign Het
Atp6v1e1 G A 6: 120,804,083 T87M probably null Het
Bap1 T C 14: 31,258,445 probably benign Het
Brf1 A G 12: 112,965,887 L385P probably benign Het
C1qtnf1 A T 11: 118,448,112 N203Y probably damaging Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccnjl A C 11: 43,579,891 D162A probably damaging Het
Cd248 A C 19: 5,069,167 I348L probably benign Het
Cdc20 T C 4: 118,435,832 T265A probably benign Het
Cdca5 T A 19: 6,090,397 L196* probably null Het
Cdk4 T A 10: 127,064,575 probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Clec4b2 G T 6: 123,201,040 E105* probably null Het
Dapk1 T A 13: 60,761,786 D1404E probably benign Het
Dnah1 T C 14: 31,267,539 Y3308C probably damaging Het
Dnah17 A C 11: 118,078,593 Y2260D probably damaging Het
Dock8 T G 19: 25,181,637 S1720A probably benign Het
Erc1 A G 6: 119,777,986 probably null Het
Ergic1 A G 17: 26,629,623 I66V probably benign Het
Fam186a T C 15: 99,945,277 T1029A possibly damaging Het
Fat4 A T 3: 38,980,632 Y2811F probably damaging Het
Flt3 A G 5: 147,369,300 M310T probably damaging Het
Ganab T A 19: 8,914,991 C844S probably benign Het
Gas2l2 C A 11: 83,429,215 V72F probably damaging Het
Gm14401 T A 2: 177,086,780 C220S probably damaging Het
Gm9745 T G 13: 8,940,601 probably benign Het
Hmmr A T 11: 40,728,434 V73E probably benign Het
Ifih1 G T 2: 62,635,014 probably benign Het
Jak3 A G 8: 71,685,404 E833G probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Ldb1 G A 19: 46,034,693 A217V probably benign Het
Lrrc8c A G 5: 105,608,089 T577A probably benign Het
Mfn1 T A 3: 32,546,562 probably benign Het
Mki67 G A 7: 135,696,745 P2187S probably damaging Het
Mrc1 T A 2: 14,319,141 D1096E probably benign Het
Msi1 A G 5: 115,435,595 probably benign Het
Msto1 T A 3: 88,912,252 I152F probably benign Het
Myo9a A G 9: 59,896,517 R2060G probably benign Het
Nnt A T 13: 119,404,571 C44* probably null Het
Nup210l A G 3: 90,193,071 D1468G probably damaging Het
Olfr1176 C A 2: 88,344,342 C129F possibly damaging Het
Olfr1257 A G 2: 89,881,132 E102G probably benign Het
Olfr19 T C 16: 16,673,618 D121G probably damaging Het
Olfr345 T C 2: 36,640,894 L285P probably damaging Het
P2rx3 G A 2: 85,024,926 T62I probably damaging Het
Pabpc4l G T 3: 46,447,143 T22K probably damaging Het
Pcdha7 A G 18: 36,975,593 D557G probably damaging Het
Pcdhb20 A G 18: 37,506,245 K608R possibly damaging Het
Pcnx A G 12: 81,918,165 S369G probably damaging Het
Plod1 T C 4: 147,920,279 I455V probably benign Het
Prune2 A T 19: 17,121,855 E1574D probably benign Het
Ptar1 T A 19: 23,703,108 L96H probably damaging Het
Rabgap1 T C 2: 37,560,571 S904P probably benign Het
Rps6ka4 C T 19: 6,838,099 V176I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Runx1t1 T A 4: 13,771,459 M1K probably null Het
Serinc4 T A 2: 121,452,424 Y419F probably damaging Het
Serpina12 A T 12: 104,037,797 M192K possibly damaging Het
Spata21 T A 4: 141,104,950 M474K probably damaging Het
Stpg1 T C 4: 135,519,365 S135P possibly damaging Het
Tdrkh A G 3: 94,429,364 D481G probably damaging Het
Ube2e1 A C 14: 18,285,268 S68R probably damaging Het
Vcpip1 A C 1: 9,747,347 N270K probably damaging Het
Vmn2r79 T C 7: 87,001,467 F154L probably benign Het
Vwa3b A G 1: 37,114,603 probably benign Het
Xdh C A 17: 73,900,708 V885L probably benign Het
Zfp141 A T 7: 42,476,205 V281D probably benign Het
Zfp317 T A 9: 19,646,847 I119N probably benign Het
Zfp345 G A 2: 150,472,688 R310C probably benign Het
Zfp760 G A 17: 21,723,248 C468Y probably benign Het
Other mutations in Arhgef18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00790:Arhgef18 APN 8 3429553 missense probably damaging 1.00
IGL01649:Arhgef18 APN 8 3441211 splice site probably benign
IGL01736:Arhgef18 APN 8 3451624 splice site probably benign
IGL02206:Arhgef18 APN 8 3445034 missense probably benign 0.00
IGL02401:Arhgef18 APN 8 3437078 missense probably damaging 1.00
IGL02938:Arhgef18 APN 8 3450802 missense probably benign 0.02
IGL02943:Arhgef18 APN 8 3448553 missense probably damaging 0.99
IGL02990:Arhgef18 APN 8 3444904 missense probably benign 0.02
IGL03162:Arhgef18 APN 8 3441301 splice site probably null
R1622:Arhgef18 UTSW 8 3441272 missense possibly damaging 0.46
R1681:Arhgef18 UTSW 8 3439645 missense probably damaging 1.00
R1726:Arhgef18 UTSW 8 3454228 missense possibly damaging 0.46
R2126:Arhgef18 UTSW 8 3451939 missense probably damaging 0.99
R2161:Arhgef18 UTSW 8 3439575 nonsense probably null
R2878:Arhgef18 UTSW 8 3432759 missense probably benign
R3916:Arhgef18 UTSW 8 3454197 missense probably benign
R4231:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4233:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4234:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4235:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4236:Arhgef18 UTSW 8 3450317 missense possibly damaging 0.80
R4450:Arhgef18 UTSW 8 3437097 missense probably damaging 0.97
R4539:Arhgef18 UTSW 8 3447070 missense probably benign
R4670:Arhgef18 UTSW 8 3434897 missense probably damaging 1.00
R4753:Arhgef18 UTSW 8 3444938 missense probably damaging 1.00
R5313:Arhgef18 UTSW 8 3451629 critical splice acceptor site probably null
R5698:Arhgef18 UTSW 8 3439499 missense probably damaging 0.99
R5781:Arhgef18 UTSW 8 3439439 intron probably null
R5851:Arhgef18 UTSW 8 3434980 missense probably damaging 1.00
R5897:Arhgef18 UTSW 8 3439682 missense probably damaging 1.00
R5908:Arhgef18 UTSW 8 3453165 missense probably damaging 1.00
R6123:Arhgef18 UTSW 8 3437091 missense probably damaging 0.99
R6136:Arhgef18 UTSW 8 3454507 missense probably benign
R6240:Arhgef18 UTSW 8 3439658 missense probably damaging 1.00
R6617:Arhgef18 UTSW 8 3439592 missense probably damaging 1.00
R7575:Arhgef18 UTSW 8 3451635 missense probably damaging 0.99
R7851:Arhgef18 UTSW 8 3448409 missense possibly damaging 0.46
R8030:Arhgef18 UTSW 8 3439600 missense probably damaging 1.00
X0021:Arhgef18 UTSW 8 3434942 missense probably damaging 1.00
Z1088:Arhgef18 UTSW 8 3439628 missense probably damaging 1.00
Z1176:Arhgef18 UTSW 8 3453224 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCCTAGCAGAGTACCAAGC -3'
(R):5'- TCTGTCTGGGAGATCAAGGC -3'

Sequencing Primer
(F):5'- GGCAGCTAAGATCACTCTCTG -3'
(R):5'- TCAAGGCCACAAGTGAGTG -3'
Posted On2016-03-17