Incidental Mutation 'R0281:Cep192'
ID 37582
Institutional Source Beutler Lab
Gene Symbol Cep192
Ensembl Gene ENSMUSG00000024542
Gene Name centrosomal protein 192
Synonyms 4631422C13Rik, D430014P18Rik
MMRRC Submission 038503-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0281 (G1)
Quality Score 225
Status Validated
Chromosome 18
Chromosomal Location 67800107-67885170 bp(+) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 67828482 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000025425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025425]
AlphaFold E9Q4Y4
Predicted Effect probably benign
Transcript: ENSMUST00000025425
SMART Domains Protein: ENSMUSP00000025425
Gene: ENSMUSG00000024542

DomainStartEndE-ValueType
low complexity region 70 84 N/A INTRINSIC
low complexity region 195 217 N/A INTRINSIC
low complexity region 975 991 N/A INTRINSIC
low complexity region 1189 1204 N/A INTRINSIC
low complexity region 2051 2069 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225077
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.9%
Validation Efficiency 98% (104/106)
Allele List at MGI
Other mutations in this stock
Total: 101 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
2610507B11Rik C T 11: 78,271,924 L871F possibly damaging Het
4933430I17Rik A T 4: 62,546,067 R374* probably null Het
5930422O12Rik A T 8: 33,429,379 R76* probably null Het
A1cf G A 19: 31,945,814 A505T probably benign Het
Abcc5 T A 16: 20,422,400 I12F probably damaging Het
Abcf2 T C 5: 24,566,564 E555G probably damaging Het
Acan A T 7: 79,100,285 E1601D probably damaging Het
Adam2 T A 14: 66,037,606 K559N probably benign Het
Akap11 A C 14: 78,510,089 D1619E possibly damaging Het
Ankrd11 T C 8: 122,895,568 D515G probably benign Het
Ankrd27 T A 7: 35,619,371 N562K probably damaging Het
Atp10b T C 11: 43,153,304 I119T probably benign Het
Atr T C 9: 95,937,566 I2202T probably benign Het
BC067074 A T 13: 113,369,143 I727F probably damaging Het
Brd4 T A 17: 32,213,540 probably benign Het
Catsperg2 C T 7: 29,706,571 C634Y possibly damaging Het
Cfap65 T A 1: 74,927,071 I366F probably damaging Het
Cnga4 G T 7: 105,407,668 R326L probably damaging Het
Cntnap5b T A 1: 100,072,153 M212K probably benign Het
Col6a6 T A 9: 105,784,116 M265L probably benign Het
Cyp26b1 A T 6: 84,574,556 F417Y probably damaging Het
Dhx15 A T 5: 52,150,746 M768K probably benign Het
Drc7 G A 8: 95,071,253 R433H possibly damaging Het
Duox2 C T 2: 122,292,304 V550M probably benign Het
Elmo2 A G 2: 165,296,890 L456P probably damaging Het
Fbxo39 T C 11: 72,317,530 I236T probably benign Het
Fezf2 A G 14: 12,343,977 C305R probably damaging Het
Fndc3b C A 3: 27,457,006 C785F probably benign Het
Gm12253 T C 11: 58,440,012 probably benign Het
Gnat2 T A 3: 108,095,562 Y95* probably null Het
Gopc T C 10: 52,350,678 K220E probably damaging Het
Hectd4 G A 5: 121,254,251 D193N possibly damaging Het
Hexa G A 9: 59,554,226 probably null Het
Hspa4l T C 3: 40,785,408 probably benign Het
Hspa5 T C 2: 34,774,320 S301P probably damaging Het
Ice1 A T 13: 70,604,047 S1307T possibly damaging Het
Igtp T C 11: 58,206,054 L17P probably damaging Het
Itk T C 11: 46,353,916 Y225C probably damaging Het
Kifc3 A G 8: 95,103,460 V560A probably damaging Het
Lama1 A G 17: 67,817,569 N2875D probably damaging Het
Lasp1 C A 11: 97,806,851 C32* probably null Het
Lcp2 T A 11: 34,069,854 probably benign Het
Lhx9 C T 1: 138,832,904 G236D probably benign Het
Lrrc38 A T 4: 143,350,409 I81F probably damaging Het
Ly6a C T 15: 74,995,387 V94M probably benign Het
Map3k13 A G 16: 21,914,157 E503G probably damaging Het
Mertk T C 2: 128,782,621 probably benign Het
Mkl2 T A 16: 13,412,163 I915N probably damaging Het
Msantd2 G A 9: 37,523,219 D252N possibly damaging Het
Mtmr12 T A 15: 12,257,706 L290* probably null Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Naglu T A 11: 101,074,027 N313K probably damaging Het
Nceh1 T C 3: 27,222,804 V92A possibly damaging Het
Ncf4 A G 15: 78,250,883 T47A probably damaging Het
Nrp1 T A 8: 128,460,683 F403L probably damaging Het
Nxph3 T C 11: 95,511,256 T111A possibly damaging Het
Obscn T A 11: 59,038,615 E6061V probably damaging Het
Obsl1 C A 1: 75,492,927 G1149W probably damaging Het
Olfr1162 C T 2: 88,050,412 V71I possibly damaging Het
Olfr1370 T A 13: 21,072,374 Y309F probably benign Het
Olfr1487 A G 19: 13,619,485 T65A probably benign Het
Olfr267 A T 4: 58,784,981 V247E probably damaging Het
Olfr292 A G 7: 86,694,860 T135A probably benign Het
Olfr493 A C 7: 108,346,914 D22E probably benign Het
Olfr814 T A 10: 129,874,546 L70F possibly damaging Het
Pde9a T C 17: 31,455,106 V55A probably damaging Het
Pip4k2c A T 10: 127,205,821 probably null Het
Plvap T C 8: 71,511,382 N112S probably damaging Het
Pop1 T A 15: 34,529,858 probably null Het
Ppip5k2 T C 1: 97,716,553 H1113R possibly damaging Het
Ptprk A T 10: 28,573,392 I962F probably damaging Het
Rad51ap2 T C 12: 11,457,042 S322P possibly damaging Het
Rasal1 A G 5: 120,674,605 T565A probably benign Het
Rbm15 C A 3: 107,331,155 R642S probably damaging Het
Rpsa G A 9: 120,131,003 E211K possibly damaging Het
Ryr3 A G 2: 112,686,810 S3303P probably damaging Het
Scg2 T A 1: 79,435,512 N458I possibly damaging Het
Setx A G 2: 29,179,643 T2487A probably benign Het
Slc4a5 G A 6: 83,267,567 probably benign Het
Slc8a2 T A 7: 16,140,989 D387E probably benign Het
Smarcc2 A G 10: 128,474,722 T407A probably benign Het
Snap25 A G 2: 136,777,464 D179G probably damaging Het
Socs4 T C 14: 47,289,868 S74P probably benign Het
Sp6 T A 11: 97,021,925 Y155N probably benign Het
Srrt C T 5: 137,296,127 probably benign Het
Steap1 C T 5: 5,736,431 M335I probably benign Het
Stra6 A T 9: 58,145,489 Y250F probably benign Het
Svil T C 18: 5,094,582 S1421P probably damaging Het
Tcea3 G A 4: 136,271,366 C317Y probably damaging Het
Tmco6 T C 18: 36,737,704 L117S probably damaging Het
Trp53bp1 T C 2: 121,270,237 K89E probably damaging Het
Trp63 T A 16: 25,764,302 probably benign Het
Ube2d2a A G 18: 35,800,132 Y74C probably damaging Het
Usp19 T G 9: 108,498,509 F885V probably damaging Het
Utp18 T A 11: 93,882,177 probably benign Het
Vmn2r116 T C 17: 23,401,413 I707T possibly damaging Het
Vmn2r68 T A 7: 85,233,249 probably benign Het
Vmn2r68 C G 7: 85,233,258 probably null Het
Zfp318 C T 17: 46,412,614 P1848S probably benign Het
Zfp984 G T 4: 147,755,265 N376K probably benign Het
Other mutations in Cep192
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00156:Cep192 APN 18 67820336 missense probably damaging 1.00
IGL00163:Cep192 APN 18 67880800 missense possibly damaging 0.61
IGL00509:Cep192 APN 18 67858868 missense possibly damaging 0.78
IGL01012:Cep192 APN 18 67812406 missense possibly damaging 0.95
IGL01143:Cep192 APN 18 67804375 missense probably damaging 0.97
IGL01302:Cep192 APN 18 67858903 missense probably benign 0.03
IGL01653:Cep192 APN 18 67852972 missense possibly damaging 0.57
IGL02202:Cep192 APN 18 67803137 missense possibly damaging 0.83
IGL02448:Cep192 APN 18 67869447 missense probably benign 0.25
IGL02494:Cep192 APN 18 67804383 missense probably benign 0.00
IGL02574:Cep192 APN 18 67841279 missense probably damaging 0.99
IGL02624:Cep192 APN 18 67880795 missense probably benign 0.20
IGL02646:Cep192 APN 18 67862477 missense probably damaging 1.00
IGL02652:Cep192 APN 18 67858850 splice site probably benign
IGL02684:Cep192 APN 18 67834563 missense probably damaging 0.99
IGL02977:Cep192 APN 18 67852905 missense probably damaging 0.97
IGL03000:Cep192 APN 18 67852044 missense probably damaging 1.00
IGL03133:Cep192 APN 18 67810105 missense probably benign 0.00
IGL03139:Cep192 APN 18 67828476 critical splice donor site probably null
IGL03213:Cep192 APN 18 67865637 missense probably damaging 1.00
IGL03250:Cep192 APN 18 67807355 missense probably benign 0.01
IGL03259:Cep192 APN 18 67820412 missense probably damaging 1.00
R0117:Cep192 UTSW 18 67850737 critical splice donor site probably null
R0180:Cep192 UTSW 18 67835488 missense probably damaging 1.00
R0374:Cep192 UTSW 18 67818883 nonsense probably null
R0420:Cep192 UTSW 18 67813893 missense possibly damaging 0.91
R0479:Cep192 UTSW 18 67858018 missense probably damaging 1.00
R0652:Cep192 UTSW 18 67807265 missense probably benign 0.04
R1024:Cep192 UTSW 18 67838054 missense probably benign 0.37
R1382:Cep192 UTSW 18 67856299 missense possibly damaging 0.74
R1394:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1395:Cep192 UTSW 18 67858921 missense probably damaging 1.00
R1641:Cep192 UTSW 18 67847433 missense probably damaging 1.00
R1704:Cep192 UTSW 18 67856256 missense probably damaging 1.00
R1793:Cep192 UTSW 18 67851767 missense possibly damaging 0.74
R1835:Cep192 UTSW 18 67804424 missense possibly damaging 0.95
R1978:Cep192 UTSW 18 67803158 critical splice donor site probably null
R2164:Cep192 UTSW 18 67820360 missense probably damaging 0.99
R2180:Cep192 UTSW 18 67824742 missense possibly damaging 0.82
R2307:Cep192 UTSW 18 67813899 missense probably benign 0.07
R2442:Cep192 UTSW 18 67824688 missense possibly damaging 0.89
R2897:Cep192 UTSW 18 67855270 splice site probably null
R2898:Cep192 UTSW 18 67855270 splice site probably null
R2901:Cep192 UTSW 18 67869441 missense possibly damaging 0.94
R3433:Cep192 UTSW 18 67834892 missense probably benign 0.08
R3620:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3621:Cep192 UTSW 18 67829857 missense probably benign 0.00
R3712:Cep192 UTSW 18 67820329 missense probably benign 0.00
R4559:Cep192 UTSW 18 67871513 missense probably damaging 1.00
R4590:Cep192 UTSW 18 67816791 nonsense probably null
R4591:Cep192 UTSW 18 67834968 missense probably damaging 0.99
R4604:Cep192 UTSW 18 67815922 missense possibly damaging 0.64
R4627:Cep192 UTSW 18 67812369 missense probably benign 0.03
R4725:Cep192 UTSW 18 67816766 missense probably benign
R4738:Cep192 UTSW 18 67884830 nonsense probably null
R4739:Cep192 UTSW 18 67851732 missense probably benign 0.02
R4927:Cep192 UTSW 18 67835124 missense probably benign 0.16
R4948:Cep192 UTSW 18 67816804 missense probably benign 0.00
R5090:Cep192 UTSW 18 67860546 missense possibly damaging 0.60
R5105:Cep192 UTSW 18 67866541 missense probably benign 0.08
R5154:Cep192 UTSW 18 67850684 missense probably damaging 1.00
R5192:Cep192 UTSW 18 67835004 missense probably benign 0.03
R5735:Cep192 UTSW 18 67880795 missense probably benign 0.20
R5812:Cep192 UTSW 18 67851737 missense possibly damaging 0.49
R5869:Cep192 UTSW 18 67815864 missense probably benign 0.01
R5981:Cep192 UTSW 18 67860590 missense probably damaging 1.00
R6131:Cep192 UTSW 18 67837997 missense possibly damaging 0.65
R6335:Cep192 UTSW 18 67834713 missense probably damaging 1.00
R6849:Cep192 UTSW 18 67812435 missense probably benign 0.00
R6861:Cep192 UTSW 18 67841628 missense probably benign 0.43
R7192:Cep192 UTSW 18 67850528 missense probably damaging 0.99
R7264:Cep192 UTSW 18 67820355 missense probably damaging 1.00
R7397:Cep192 UTSW 18 67856197 missense probably damaging 1.00
R7409:Cep192 UTSW 18 67834803 missense possibly damaging 0.76
R7696:Cep192 UTSW 18 67820363 missense probably damaging 1.00
R7756:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
R7758:Cep192 UTSW 18 67856313 missense possibly damaging 0.92
R8247:Cep192 UTSW 18 67841117 missense probably benign 0.02
R8695:Cep192 UTSW 18 67818887 nonsense probably null
R8865:Cep192 UTSW 18 67834632 missense probably benign 0.01
R8935:Cep192 UTSW 18 67862472 missense probably damaging 1.00
R9453:Cep192 UTSW 18 67856283 nonsense probably null
R9571:Cep192 UTSW 18 67819038 missense probably damaging 0.98
R9581:Cep192 UTSW 18 67847394 missense probably damaging 1.00
R9599:Cep192 UTSW 18 67835454 missense probably benign 0.19
R9779:Cep192 UTSW 18 67835277 missense probably damaging 1.00
RF003:Cep192 UTSW 18 67837956 missense probably benign 0.44
X0066:Cep192 UTSW 18 67812449 splice site probably null
Z1176:Cep192 UTSW 18 67881288 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGCCAATAAACAGTGAGTGTCCGTAA -3'
(R):5'- CAGTTGAAAAGGAAATGTGAGTgccg -3'

Sequencing Primer
(F):5'- GTCCGTAACACTTACTGAAGTGC -3'
(R):5'- CACTGTGTACATCTTCACGC -3'
Posted On 2013-05-23