Incidental Mutation 'R4897:C1qtnf1'
ID375829
Institutional Source Beutler Lab
Gene Symbol C1qtnf1
Ensembl Gene ENSMUSG00000017446
Gene NameC1q and tumor necrosis factor related protein 1
Synonyms1600017K21Rik, CTRP1
MMRRC Submission 042501-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4897 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location118428203-118449963 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 118448112 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Tyrosine at position 203 (N203Y)
Ref Sequence ENSEMBL: ENSMUSP00000101893 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017590] [ENSMUST00000106286] [ENSMUST00000124861] [ENSMUST00000133558]
Predicted Effect probably damaging
Transcript: ENSMUST00000017590
AA Change: N203Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000017590
Gene: ENSMUSG00000017446
AA Change: N203Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 85 96 N/A INTRINSIC
C1Q 140 278 8.4e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106286
AA Change: N203Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101893
Gene: ENSMUSG00000017446
AA Change: N203Y

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
low complexity region 85 96 N/A INTRINSIC
C1Q 140 278 8.6e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124861
Predicted Effect probably benign
Transcript: ENSMUST00000133558
SMART Domains Protein: ENSMUSP00000117467
Gene: ENSMUSG00000017446

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 31 42 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142751
Meta Mutation Damage Score 0.6557 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (79/79)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit altered glucose and lipid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,376,297 M120I probably damaging Het
4933427D14Rik A T 11: 72,191,516 L328Q probably damaging Het
Adgrv1 A C 13: 81,561,585 probably null Het
Ankrd46 A T 15: 36,484,133 probably benign Het
Arhgef18 A T 8: 3,444,979 M413L probably benign Het
Atp6v1e1 G A 6: 120,804,083 T87M probably null Het
Bap1 T C 14: 31,258,445 probably benign Het
Brf1 A G 12: 112,965,887 L385P probably benign Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccnjl A C 11: 43,579,891 D162A probably damaging Het
Cd248 A C 19: 5,069,167 I348L probably benign Het
Cdc20 T C 4: 118,435,832 T265A probably benign Het
Cdca5 T A 19: 6,090,397 L196* probably null Het
Cdk4 T A 10: 127,064,575 probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Clec4b2 G T 6: 123,201,040 E105* probably null Het
Dapk1 T A 13: 60,761,786 D1404E probably benign Het
Dnah1 T C 14: 31,267,539 Y3308C probably damaging Het
Dnah17 A C 11: 118,078,593 Y2260D probably damaging Het
Dock8 T G 19: 25,181,637 S1720A probably benign Het
Erc1 A G 6: 119,777,986 probably null Het
Ergic1 A G 17: 26,629,623 I66V probably benign Het
Fam186a T C 15: 99,945,277 T1029A possibly damaging Het
Fat4 A T 3: 38,980,632 Y2811F probably damaging Het
Flt3 A G 5: 147,369,300 M310T probably damaging Het
Ganab T A 19: 8,914,991 C844S probably benign Het
Gas2l2 C A 11: 83,429,215 V72F probably damaging Het
Gm14401 T A 2: 177,086,780 C220S probably damaging Het
Gm9745 T G 13: 8,940,601 probably benign Het
Hmmr A T 11: 40,728,434 V73E probably benign Het
Ifih1 G T 2: 62,635,014 probably benign Het
Jak3 A G 8: 71,685,404 E833G probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Ldb1 G A 19: 46,034,693 A217V probably benign Het
Lrrc8c A G 5: 105,608,089 T577A probably benign Het
Mfn1 T A 3: 32,546,562 probably benign Het
Mki67 G A 7: 135,696,745 P2187S probably damaging Het
Mrc1 T A 2: 14,319,141 D1096E probably benign Het
Msi1 A G 5: 115,435,595 probably benign Het
Msto1 T A 3: 88,912,252 I152F probably benign Het
Myo9a A G 9: 59,896,517 R2060G probably benign Het
Nnt A T 13: 119,404,571 C44* probably null Het
Nup210l A G 3: 90,193,071 D1468G probably damaging Het
Olfr1176 C A 2: 88,344,342 C129F possibly damaging Het
Olfr1257 A G 2: 89,881,132 E102G probably benign Het
Olfr19 T C 16: 16,673,618 D121G probably damaging Het
Olfr345 T C 2: 36,640,894 L285P probably damaging Het
P2rx3 G A 2: 85,024,926 T62I probably damaging Het
Pabpc4l G T 3: 46,447,143 T22K probably damaging Het
Pcdha7 A G 18: 36,975,593 D557G probably damaging Het
Pcdhb20 A G 18: 37,506,245 K608R possibly damaging Het
Pcnx A G 12: 81,918,165 S369G probably damaging Het
Plod1 T C 4: 147,920,279 I455V probably benign Het
Prune2 A T 19: 17,121,855 E1574D probably benign Het
Ptar1 T A 19: 23,703,108 L96H probably damaging Het
Rabgap1 T C 2: 37,560,571 S904P probably benign Het
Rps6ka4 C T 19: 6,838,099 V176I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Runx1t1 T A 4: 13,771,459 M1K probably null Het
Serinc4 T A 2: 121,452,424 Y419F probably damaging Het
Serpina12 A T 12: 104,037,797 M192K possibly damaging Het
Spata21 T A 4: 141,104,950 M474K probably damaging Het
Stpg1 T C 4: 135,519,365 S135P possibly damaging Het
Tdrkh A G 3: 94,429,364 D481G probably damaging Het
Ube2e1 A C 14: 18,285,268 S68R probably damaging Het
Vcpip1 A C 1: 9,747,347 N270K probably damaging Het
Vmn2r79 T C 7: 87,001,467 F154L probably benign Het
Vwa3b A G 1: 37,114,603 probably benign Het
Xdh C A 17: 73,900,708 V885L probably benign Het
Zfp141 A T 7: 42,476,205 V281D probably benign Het
Zfp317 T A 9: 19,646,847 I119N probably benign Het
Zfp345 G A 2: 150,472,688 R310C probably benign Het
Zfp760 G A 17: 21,723,248 C468Y probably benign Het
Other mutations in C1qtnf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01805:C1qtnf1 APN 11 118448167 missense probably damaging 1.00
IGL02376:C1qtnf1 APN 11 118448068 missense probably benign 0.29
IGL02609:C1qtnf1 APN 11 118448004 missense probably damaging 1.00
R0594:C1qtnf1 UTSW 11 118446628 missense possibly damaging 0.96
R1170:C1qtnf1 UTSW 11 118448269 missense probably damaging 1.00
R1442:C1qtnf1 UTSW 11 118448185 missense probably damaging 1.00
R1526:C1qtnf1 UTSW 11 118443790 missense possibly damaging 0.92
R1540:C1qtnf1 UTSW 11 118447923 missense probably benign 0.28
R1896:C1qtnf1 UTSW 11 118443757 missense probably damaging 1.00
R2011:C1qtnf1 UTSW 11 118448284 missense probably benign 0.04
R2012:C1qtnf1 UTSW 11 118448284 missense probably benign 0.04
R2901:C1qtnf1 UTSW 11 118448104 unclassified probably null
R2902:C1qtnf1 UTSW 11 118448104 unclassified probably null
R4011:C1qtnf1 UTSW 11 118446539 missense probably benign
R6335:C1qtnf1 UTSW 11 118448134 missense probably damaging 1.00
R7250:C1qtnf1 UTSW 11 118448350 makesense probably null
X0021:C1qtnf1 UTSW 11 118443780 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CAGAAGGGATCCATTGGAGC -3'
(R):5'- CTCGTCACTGAAAATGGCGTTC -3'

Sequencing Primer
(F):5'- TGCAAGAGCCAGTACGC -3'
(R):5'- CTCACGCTCGCCCTTGAAG -3'
Posted On2016-03-17