Mutagenetix > Incidental Mutation

Incidental Mutation 'R0281:A1cf'

37584

Institutional Source

Beutler Lab

Gene Symbol

A1cf

Ensembl Gene

ENSMUSG00000052595

Gene Name

APOBEC1 complementation factor

Synonyms

apobec-1 complementation factor, ACF, 1810073H04Rik

MMRRC Submission

038503-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.098) question?

Stock #

R0281 (G1)

Quality Score

133

Status

Validated

Chromosome

Chromosomal Location

31868764-31948573 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 31945814 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Alanine to Threonine at position 505 (A505T)

Ref Sequence

ENSEMBL: ENSMUSP00000075235 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000075838] [ENSMUST00000224304]

AlphaFold

Q5YD48

Predicted Effect

probably benign
Transcript: ENSMUST00000075838
AA Change: A505T

PolyPhen 2 Score 0.087 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000075235
Gene: ENSMUSG00000052595
AA Change: A505T

Domain	Start	End	E-Value	Type
RRM	57	130	2.13e-18	SMART
RRM	137	214	1.59e-8	SMART
RRM	232	299	1.36e-16	SMART
low complexity region	386	411	N/A	INTRINSIC
Pfam:DND1_DSRM	445	523	1.6e-30	PFAM
low complexity region	526	542	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000224304
AA Change: A497T

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

Meta Mutation Damage Score

0.0852

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.9%

Validation Efficiency

98% (104/106)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian apolipoprotein B mRNA undergoes site-specific C to U deamination, which is mediated by a multi-component enzyme complex containing a minimal core composed of APOBEC-1 and a complementation factor encoded by this gene. The gene product has three non-identical RNA recognition motifs and belongs to the hnRNP R family of RNA-binding proteins. It has been proposed that this complementation factor functions as an RNA-binding subunit and docks APOBEC-1 to deaminate the upstream cytidine. Studies suggest that the protein may also be involved in other RNA editing or RNA processing events. Several transcript variants encoding a few different isoforms have been found for this gene. [provided by RefSeq, Nov 2010]
PHENOTYPE: Embryos homozygous for a targeted deletion of this gene are detectable only until the blastocyst stage (E3.5) and isolated mutant blastocysts fail to proliferate in vitro. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 101 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700061G19Rik	T	A	17: 56,885,169	Y577*	probably null	Het
2610507B11Rik	C	T	11: 78,271,924	L871F	possibly damaging	Het
4933430I17Rik	A	T	4: 62,546,067	R374*	probably null	Het
5930422O12Rik	A	T	8: 33,429,379	R76*	probably null	Het
Abcc5	T	A	16: 20,422,400	I12F	probably damaging	Het
Abcf2	T	C	5: 24,566,564	E555G	probably damaging	Het
Acan	A	T	7: 79,100,285	E1601D	probably damaging	Het
Adam2	T	A	14: 66,037,606	K559N	probably benign	Het
Akap11	A	C	14: 78,510,089	D1619E	possibly damaging	Het
Ankrd11	T	C	8: 122,895,568	D515G	probably benign	Het
Ankrd27	T	A	7: 35,619,371	N562K	probably damaging	Het
Atp10b	T	C	11: 43,153,304	I119T	probably benign	Het
Atr	T	C	9: 95,937,566	I2202T	probably benign	Het
BC067074	A	T	13: 113,369,143	I727F	probably damaging	Het
Brd4	T	A	17: 32,213,540		probably benign	Het
Catsperg2	C	T	7: 29,706,571	C634Y	possibly damaging	Het
Cep192	A	G	18: 67,828,482		probably benign	Het
Cfap65	T	A	1: 74,927,071	I366F	probably damaging	Het
Cnga4	G	T	7: 105,407,668	R326L	probably damaging	Het
Cntnap5b	T	A	1: 100,072,153	M212K	probably benign	Het
Col6a6	T	A	9: 105,784,116	M265L	probably benign	Het
Cyp26b1	A	T	6: 84,574,556	F417Y	probably damaging	Het
Dhx15	A	T	5: 52,150,746	M768K	probably benign	Het
Drc7	G	A	8: 95,071,253	R433H	possibly damaging	Het
Duox2	C	T	2: 122,292,304	V550M	probably benign	Het
Elmo2	A	G	2: 165,296,890	L456P	probably damaging	Het
Fbxo39	T	C	11: 72,317,530	I236T	probably benign	Het
Fezf2	A	G	14: 12,343,977	C305R	probably damaging	Het
Fndc3b	C	A	3: 27,457,006	C785F	probably benign	Het
Gm12253	T	C	11: 58,440,012		probably benign	Het
Gnat2	T	A	3: 108,095,562	Y95*	probably null	Het
Gopc	T	C	10: 52,350,678	K220E	probably damaging	Het
Hectd4	G	A	5: 121,254,251	D193N	possibly damaging	Het
Hexa	G	A	9: 59,554,226		probably null	Het
Hspa4l	T	C	3: 40,785,408		probably benign	Het
Hspa5	T	C	2: 34,774,320	S301P	probably damaging	Het
Ice1	A	T	13: 70,604,047	S1307T	possibly damaging	Het
Igtp	T	C	11: 58,206,054	L17P	probably damaging	Het
Itk	T	C	11: 46,353,916	Y225C	probably damaging	Het
Kifc3	A	G	8: 95,103,460	V560A	probably damaging	Het
Lama1	A	G	17: 67,817,569	N2875D	probably damaging	Het
Lasp1	C	A	11: 97,806,851	C32*	probably null	Het
Lcp2	T	A	11: 34,069,854		probably benign	Het
Lhx9	C	T	1: 138,832,904	G236D	probably benign	Het
Lrrc38	A	T	4: 143,350,409	I81F	probably damaging	Het
Ly6a	C	T	15: 74,995,387	V94M	probably benign	Het
Map3k13	A	G	16: 21,914,157	E503G	probably damaging	Het
Mertk	T	C	2: 128,782,621		probably benign	Het
Mkl2	T	A	16: 13,412,163	I915N	probably damaging	Het
Msantd2	G	A	9: 37,523,219	D252N	possibly damaging	Het
Mtmr12	T	A	15: 12,257,706	L290*	probably null	Het
Myo3a	T	C	2: 22,245,598	I92T	probably benign	Het
Naglu	T	A	11: 101,074,027	N313K	probably damaging	Het
Nceh1	T	C	3: 27,222,804	V92A	possibly damaging	Het
Ncf4	A	G	15: 78,250,883	T47A	probably damaging	Het
Nrp1	T	A	8: 128,460,683	F403L	probably damaging	Het
Nxph3	T	C	11: 95,511,256	T111A	possibly damaging	Het
Obscn	T	A	11: 59,038,615	E6061V	probably damaging	Het
Obsl1	C	A	1: 75,492,927	G1149W	probably damaging	Het
Olfr1162	C	T	2: 88,050,412	V71I	possibly damaging	Het
Olfr1370	T	A	13: 21,072,374	Y309F	probably benign	Het
Olfr1487	A	G	19: 13,619,485	T65A	probably benign	Het
Olfr267	A	T	4: 58,784,981	V247E	probably damaging	Het
Olfr292	A	G	7: 86,694,860	T135A	probably benign	Het
Olfr493	A	C	7: 108,346,914	D22E	probably benign	Het
Olfr814	T	A	10: 129,874,546	L70F	possibly damaging	Het
Pde9a	T	C	17: 31,455,106	V55A	probably damaging	Het
Pip4k2c	A	T	10: 127,205,821		probably null	Het
Plvap	T	C	8: 71,511,382	N112S	probably damaging	Het
Pop1	T	A	15: 34,529,858		probably null	Het
Ppip5k2	T	C	1: 97,716,553	H1113R	possibly damaging	Het
Ptprk	A	T	10: 28,573,392	I962F	probably damaging	Het
Rad51ap2	T	C	12: 11,457,042	S322P	possibly damaging	Het
Rasal1	A	G	5: 120,674,605	T565A	probably benign	Het
Rbm15	C	A	3: 107,331,155	R642S	probably damaging	Het
Rpsa	G	A	9: 120,131,003	E211K	possibly damaging	Het
Ryr3	A	G	2: 112,686,810	S3303P	probably damaging	Het
Scg2	T	A	1: 79,435,512	N458I	possibly damaging	Het
Setx	A	G	2: 29,179,643	T2487A	probably benign	Het
Slc4a5	G	A	6: 83,267,567		probably benign	Het
Slc8a2	T	A	7: 16,140,989	D387E	probably benign	Het
Smarcc2	A	G	10: 128,474,722	T407A	probably benign	Het
Snap25	A	G	2: 136,777,464	D179G	probably damaging	Het
Socs4	T	C	14: 47,289,868	S74P	probably benign	Het
Sp6	T	A	11: 97,021,925	Y155N	probably benign	Het
Srrt	C	T	5: 137,296,127		probably benign	Het
Steap1	C	T	5: 5,736,431	M335I	probably benign	Het
Stra6	A	T	9: 58,145,489	Y250F	probably benign	Het
Svil	T	C	18: 5,094,582	S1421P	probably damaging	Het
Tcea3	G	A	4: 136,271,366	C317Y	probably damaging	Het
Tmco6	T	C	18: 36,737,704	L117S	probably damaging	Het
Trp53bp1	T	C	2: 121,270,237	K89E	probably damaging	Het
Trp63	T	A	16: 25,764,302		probably benign	Het
Ube2d2a	A	G	18: 35,800,132	Y74C	probably damaging	Het
Usp19	T	G	9: 108,498,509	F885V	probably damaging	Het
Utp18	T	A	11: 93,882,177		probably benign	Het
Vmn2r116	T	C	17: 23,401,413	I707T	possibly damaging	Het
Vmn2r68	T	A	7: 85,233,249		probably benign	Het
Vmn2r68	C	G	7: 85,233,258		probably null	Het
Zfp318	C	T	17: 46,412,614	P1848S	probably benign	Het
Zfp984	G	T	4: 147,755,265	N376K	probably benign	Het

Other mutations in A1cf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01330:A1cf	APN	19	31920951	missense	possibly damaging	0.90
IGL01411:A1cf	APN	19	31911229	missense	possibly damaging	0.94
IGL01445:A1cf	APN	19	31945798	missense	probably benign	0.32
IGL02165:A1cf	APN	19	31927186	missense	possibly damaging	0.92
IGL02543:A1cf	APN	19	31918095	missense	probably damaging	0.97
IGL02651:A1cf	APN	19	31932506	missense	probably benign	0.25
IGL02904:A1cf	APN	19	31934806	missense	probably damaging	1.00
Haywire	UTSW	19	31918124	critical splice donor site	probably null
R0349:A1cf	UTSW	19	31932662	missense	possibly damaging	0.62
R0662:A1cf	UTSW	19	31920938	missense	probably benign	0.00
R0697:A1cf	UTSW	19	31911167	missense	probably damaging	1.00
R1055:A1cf	UTSW	19	31932519	missense	probably benign	0.05
R1125:A1cf	UTSW	19	31920978	missense	probably benign	0.00
R1448:A1cf	UTSW	19	31908796	missense	possibly damaging	0.88
R1554:A1cf	UTSW	19	31908902	missense	possibly damaging	0.66
R1616:A1cf	UTSW	19	31934775	missense	probably damaging	0.98
R1660:A1cf	UTSW	19	31893107	nonsense	probably null
R1719:A1cf	UTSW	19	31927126	missense	probably damaging	1.00
R2338:A1cf	UTSW	19	31932545	missense	probably benign
R2435:A1cf	UTSW	19	31920894	missense	probably benign	0.02
R2890:A1cf	UTSW	19	31918017	missense	probably benign	0.05
R3688:A1cf	UTSW	19	31911169	missense	probably damaging	1.00
R4007:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R4208:A1cf	UTSW	19	31932660	missense	probably benign	0.00
R4448:A1cf	UTSW	19	31945862	missense	probably benign
R5072:A1cf	UTSW	19	31917985	missense	probably benign	0.18
R5491:A1cf	UTSW	19	31918062	missense	possibly damaging	0.57
R5636:A1cf	UTSW	19	31944982	nonsense	probably null
R5932:A1cf	UTSW	19	31893118	missense	possibly damaging	0.68
R7066:A1cf	UTSW	19	31927114	missense	probably damaging	0.99
R7211:A1cf	UTSW	19	31927141	missense	probably benign	0.23
R7413:A1cf	UTSW	19	31918124	critical splice donor site	probably null
R7545:A1cf	UTSW	19	31934790	missense	possibly damaging	0.80
R8020:A1cf	UTSW	19	31893194	missense	probably benign	0.01
R8344:A1cf	UTSW	19	31911119	missense	possibly damaging	0.77
R8497:A1cf	UTSW	19	31945850	missense	probably benign
R8989:A1cf	UTSW	19	31927156	missense	possibly damaging	0.56
R9327:A1cf	UTSW	19	31918099	missense	probably benign	0.12
R9436:A1cf	UTSW	19	31932575	missense	probably benign
Z1176:A1cf	UTSW	19	31918017	missense	probably benign	0.08

Predicted Primers

PCR Primer
(F):5'- AAGTTGCCACTTCACCGTATAACCC -3'
(R):5'- TGATTCTGGCGTGACTGATCCCTG -3'

Sequencing Primer
(F):5'- AATATCATCTGCTACCGAGGTGC -3'
(R):5'- GTGACTGATCCCTGCTCCC -3'

Posted On

2013-05-23