Incidental Mutation 'R4897:Xdh'
ID375846
Institutional Source Beutler Lab
Gene Symbol Xdh
Ensembl Gene ENSMUSG00000024066
Gene Namexanthine dehydrogenase
Synonymsxanthine oxidase, XO, Xor, Xox1, Xox-1
MMRRC Submission 042501-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.386) question?
Stock #R4897 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location73883908-73950182 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 73900708 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 885 (V885L)
Ref Sequence ENSEMBL: ENSMUSP00000024866 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024866]
Predicted Effect probably benign
Transcript: ENSMUST00000024866
AA Change: V885L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000024866
Gene: ENSMUSG00000024066
AA Change: V885L

DomainStartEndE-ValueType
Pfam:Fer2 11 81 5e-12 PFAM
Pfam:Fer2_2 90 163 4.1e-31 PFAM
low complexity region 169 182 N/A INTRINSIC
Pfam:FAD_binding_5 234 414 4.9e-47 PFAM
CO_deh_flav_C 421 525 1.16e-24 SMART
Ald_Xan_dh_C 590 696 1.23e-46 SMART
Pfam:Ald_Xan_dh_C2 704 1239 1e-200 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: This gene encodes a member of the xanthine dehydrogenase protein family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. The encoded protein exists as two distinct enzymatic forms, either as xanthine dehydrogenase, or as xanthine oxidase, and functions in purine degradation. Additional studies also suggest a role in adipogenesis, and a function as a structural protein in milk fat droplets in the lactating mammary gland. [provided by RefSeq, Jan 2014]
PHENOTYPE: Homozygotes for a null allele are small and die prematurely while heterozygous females show a lactation defect. Most homozygotes for another null allele die within the first month of renal failure associated with uric acid depletion, renal tubular damage, inflammation, fibrosis and oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,376,297 M120I probably damaging Het
4933427D14Rik A T 11: 72,191,516 L328Q probably damaging Het
Adgrv1 A C 13: 81,561,585 probably null Het
Ankrd46 A T 15: 36,484,133 probably benign Het
Arhgef18 A T 8: 3,444,979 M413L probably benign Het
Atp6v1e1 G A 6: 120,804,083 T87M probably null Het
Bap1 T C 14: 31,258,445 probably benign Het
Brf1 A G 12: 112,965,887 L385P probably benign Het
C1qtnf1 A T 11: 118,448,112 N203Y probably damaging Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccnjl A C 11: 43,579,891 D162A probably damaging Het
Cd248 A C 19: 5,069,167 I348L probably benign Het
Cdc20 T C 4: 118,435,832 T265A probably benign Het
Cdca5 T A 19: 6,090,397 L196* probably null Het
Cdk4 T A 10: 127,064,575 probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Clec4b2 G T 6: 123,201,040 E105* probably null Het
Dapk1 T A 13: 60,761,786 D1404E probably benign Het
Dnah1 T C 14: 31,267,539 Y3308C probably damaging Het
Dnah17 A C 11: 118,078,593 Y2260D probably damaging Het
Dock8 T G 19: 25,181,637 S1720A probably benign Het
Erc1 A G 6: 119,777,986 probably null Het
Ergic1 A G 17: 26,629,623 I66V probably benign Het
Fam186a T C 15: 99,945,277 T1029A possibly damaging Het
Fat4 A T 3: 38,980,632 Y2811F probably damaging Het
Flt3 A G 5: 147,369,300 M310T probably damaging Het
Ganab T A 19: 8,914,991 C844S probably benign Het
Gas2l2 C A 11: 83,429,215 V72F probably damaging Het
Gm14401 T A 2: 177,086,780 C220S probably damaging Het
Gm9745 T G 13: 8,940,601 probably benign Het
Hmmr A T 11: 40,728,434 V73E probably benign Het
Ifih1 G T 2: 62,635,014 probably benign Het
Jak3 A G 8: 71,685,404 E833G probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Ldb1 G A 19: 46,034,693 A217V probably benign Het
Lrrc8c A G 5: 105,608,089 T577A probably benign Het
Mfn1 T A 3: 32,546,562 probably benign Het
Mki67 G A 7: 135,696,745 P2187S probably damaging Het
Mrc1 T A 2: 14,319,141 D1096E probably benign Het
Msi1 A G 5: 115,435,595 probably benign Het
Msto1 T A 3: 88,912,252 I152F probably benign Het
Myo9a A G 9: 59,896,517 R2060G probably benign Het
Nnt A T 13: 119,404,571 C44* probably null Het
Nup210l A G 3: 90,193,071 D1468G probably damaging Het
Olfr1176 C A 2: 88,344,342 C129F possibly damaging Het
Olfr1257 A G 2: 89,881,132 E102G probably benign Het
Olfr19 T C 16: 16,673,618 D121G probably damaging Het
Olfr345 T C 2: 36,640,894 L285P probably damaging Het
P2rx3 G A 2: 85,024,926 T62I probably damaging Het
Pabpc4l G T 3: 46,447,143 T22K probably damaging Het
Pcdha7 A G 18: 36,975,593 D557G probably damaging Het
Pcdhb20 A G 18: 37,506,245 K608R possibly damaging Het
Pcnx A G 12: 81,918,165 S369G probably damaging Het
Plod1 T C 4: 147,920,279 I455V probably benign Het
Prune2 A T 19: 17,121,855 E1574D probably benign Het
Ptar1 T A 19: 23,703,108 L96H probably damaging Het
Rabgap1 T C 2: 37,560,571 S904P probably benign Het
Rps6ka4 C T 19: 6,838,099 V176I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Runx1t1 T A 4: 13,771,459 M1K probably null Het
Serinc4 T A 2: 121,452,424 Y419F probably damaging Het
Serpina12 A T 12: 104,037,797 M192K possibly damaging Het
Spata21 T A 4: 141,104,950 M474K probably damaging Het
Stpg1 T C 4: 135,519,365 S135P possibly damaging Het
Tdrkh A G 3: 94,429,364 D481G probably damaging Het
Ube2e1 A C 14: 18,285,268 S68R probably damaging Het
Vcpip1 A C 1: 9,747,347 N270K probably damaging Het
Vmn2r79 T C 7: 87,001,467 F154L probably benign Het
Vwa3b A G 1: 37,114,603 probably benign Het
Zfp141 A T 7: 42,476,205 V281D probably benign Het
Zfp317 T A 9: 19,646,847 I119N probably benign Het
Zfp345 G A 2: 150,472,688 R310C probably benign Het
Zfp760 G A 17: 21,723,248 C468Y probably benign Het
Other mutations in Xdh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Xdh APN 17 73923106 missense possibly damaging 0.58
IGL00556:Xdh APN 17 73884435 makesense probably null
IGL01524:Xdh APN 17 73923137 critical splice acceptor site probably null
IGL01604:Xdh APN 17 73909337 missense probably benign 0.02
IGL01625:Xdh APN 17 73916786 critical splice donor site probably null
IGL01778:Xdh APN 17 73900280 missense probably benign 0.00
IGL01804:Xdh APN 17 73892759 missense probably damaging 1.00
IGL01825:Xdh APN 17 73891245 missense probably damaging 1.00
IGL01929:Xdh APN 17 73934855 missense probably damaging 1.00
IGL02068:Xdh APN 17 73913950 missense probably damaging 1.00
IGL02079:Xdh APN 17 73891277 missense probably damaging 1.00
IGL02210:Xdh APN 17 73943895 missense probably benign 0.00
IGL02261:Xdh APN 17 73913965 missense possibly damaging 0.81
IGL02365:Xdh APN 17 73943890 missense probably benign 0.14
IGL02424:Xdh APN 17 73926570 missense probably benign 0.00
IGL02491:Xdh APN 17 73886464 missense probably damaging 0.99
IGL02525:Xdh APN 17 73924995 missense possibly damaging 0.91
IGL02578:Xdh APN 17 73906246 missense probably damaging 1.00
IGL02793:Xdh APN 17 73900581 missense probably damaging 1.00
IGL02939:Xdh APN 17 73943845 critical splice donor site probably null
IGL03327:Xdh APN 17 73916792 missense probably benign
IGL03345:Xdh APN 17 73906032 missense probably damaging 0.98
IGL03353:Xdh APN 17 73895786 missense possibly damaging 0.65
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0018:Xdh UTSW 17 73925025 missense probably benign 0.00
R0033:Xdh UTSW 17 73907632 missense probably benign 0.06
R0079:Xdh UTSW 17 73891218 missense probably damaging 1.00
R0086:Xdh UTSW 17 73884438 missense probably benign
R0319:Xdh UTSW 17 73906101 splice site probably benign
R0336:Xdh UTSW 17 73922463 missense possibly damaging 0.91
R0389:Xdh UTSW 17 73898362 missense probably damaging 1.00
R0684:Xdh UTSW 17 73943891 missense probably damaging 0.97
R0930:Xdh UTSW 17 73923082 missense probably benign 0.00
R1073:Xdh UTSW 17 73939836 missense probably benign
R1114:Xdh UTSW 17 73941149 splice site probably benign
R1201:Xdh UTSW 17 73918418 missense probably benign 0.05
R1230:Xdh UTSW 17 73891256 missense probably damaging 1.00
R1351:Xdh UTSW 17 73923078 missense probably benign 0.02
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1470:Xdh UTSW 17 73891112 missense probably damaging 1.00
R1485:Xdh UTSW 17 73914019 nonsense probably null
R1548:Xdh UTSW 17 73913901 missense probably damaging 0.98
R1637:Xdh UTSW 17 73900578 missense probably benign
R1641:Xdh UTSW 17 73926552 missense probably benign
R1758:Xdh UTSW 17 73910209 missense probably damaging 1.00
R1951:Xdh UTSW 17 73907658 missense probably damaging 1.00
R1969:Xdh UTSW 17 73892751 missense possibly damaging 0.55
R2024:Xdh UTSW 17 73921305 missense possibly damaging 0.92
R2080:Xdh UTSW 17 73909325 missense probably damaging 1.00
R2157:Xdh UTSW 17 73922537 missense probably damaging 1.00
R2300:Xdh UTSW 17 73891265 missense probably damaging 1.00
R3783:Xdh UTSW 17 73893595 splice site probably benign
R3796:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3797:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3798:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3799:Xdh UTSW 17 73907658 missense probably damaging 1.00
R3819:Xdh UTSW 17 73906725 missense probably benign 0.35
R4085:Xdh UTSW 17 73916879 missense probably benign 0.35
R4240:Xdh UTSW 17 73895795 missense possibly damaging 0.72
R4356:Xdh UTSW 17 73915690 missense probably benign 0.01
R4522:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4523:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4524:Xdh UTSW 17 73898344 missense probably damaging 1.00
R4600:Xdh UTSW 17 73910200 missense probably benign 0.19
R4617:Xdh UTSW 17 73918394 missense probably damaging 0.99
R4756:Xdh UTSW 17 73886386 missense probably benign 0.24
R4761:Xdh UTSW 17 73910267 missense possibly damaging 0.91
R4815:Xdh UTSW 17 73906215 missense probably damaging 1.00
R4850:Xdh UTSW 17 73898335 missense probably damaging 1.00
R4896:Xdh UTSW 17 73910243 missense probably damaging 0.96
R4923:Xdh UTSW 17 73924936 missense possibly damaging 0.72
R4977:Xdh UTSW 17 73898970 missense probably benign 0.05
R5030:Xdh UTSW 17 73891293 missense probably damaging 1.00
R5185:Xdh UTSW 17 73925011 missense probably damaging 1.00
R5347:Xdh UTSW 17 73925032 missense probably benign
R5556:Xdh UTSW 17 73897764 missense probably benign 0.21
R5566:Xdh UTSW 17 73893622 missense probably damaging 1.00
R5568:Xdh UTSW 17 73943885 missense possibly damaging 0.90
R5635:Xdh UTSW 17 73913875 missense possibly damaging 0.92
R5662:Xdh UTSW 17 73941115 missense probably damaging 0.99
R5955:Xdh UTSW 17 73898320 missense probably damaging 1.00
R6058:Xdh UTSW 17 73906269 missense probably damaging 1.00
R6061:Xdh UTSW 17 73921347 missense probably damaging 1.00
R6412:Xdh UTSW 17 73935907 missense probably benign 0.09
R6526:Xdh UTSW 17 73900551 missense probably damaging 0.97
R6558:Xdh UTSW 17 73893713 missense possibly damaging 0.95
R6843:Xdh UTSW 17 73923130 missense probably damaging 1.00
R6932:Xdh UTSW 17 73922562 missense probably damaging 0.99
R7028:Xdh UTSW 17 73943873 missense probably damaging 0.99
R7418:Xdh UTSW 17 73913965 missense possibly damaging 0.81
R7503:Xdh UTSW 17 73926210 missense probably damaging 1.00
R7653:Xdh UTSW 17 73897045 missense probably benign 0.10
R7763:Xdh UTSW 17 73934834 missense possibly damaging 0.69
R7768:Xdh UTSW 17 73939836 missense probably benign
R7904:Xdh UTSW 17 73922472 missense probably benign 0.09
R8010:Xdh UTSW 17 73909317 nonsense probably null
R8067:Xdh UTSW 17 73900657 missense probably benign 0.01
R8238:Xdh UTSW 17 73886417 missense probably benign
R8253:Xdh UTSW 17 73918382 missense possibly damaging 0.94
R8346:Xdh UTSW 17 73913943 missense probably damaging 1.00
R8381:Xdh UTSW 17 73912461 missense probably benign
R8427:Xdh UTSW 17 73935931 missense probably damaging 1.00
X0019:Xdh UTSW 17 73918454 missense probably damaging 1.00
Z1088:Xdh UTSW 17 73886428 missense probably benign
Z1176:Xdh UTSW 17 73923042 critical splice donor site probably null
Z1177:Xdh UTSW 17 73897695 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGTAAGGATCACTCTTCCCGC -3'
(R):5'- AAGCTGGGTTGGGGATCTAC -3'

Sequencing Primer
(F):5'- AAGCAGCTCACCTCCTCTG -3'
(R):5'- TTGGGGATCTACTTAGGAGAGTAAG -3'
Posted On2016-03-17