Incidental Mutation 'R4897:Pcdhb20'
ID375848
Institutional Source Beutler Lab
Gene Symbol Pcdhb20
Ensembl Gene ENSMUSG00000046191
Gene Nameprotocadherin beta 20
SynonymsPcdhbT, Pcdhb14
MMRRC Submission 042501-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.080) question?
Stock #R4897 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location37504264-37507822 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37506245 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 608 (K608R)
Ref Sequence ENSEMBL: ENSMUSP00000137038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052179] [ENSMUST00000059571] [ENSMUST00000115661] [ENSMUST00000194544]
Predicted Effect possibly damaging
Transcript: ENSMUST00000052179
AA Change: K608R

PolyPhen 2 Score 0.702 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000137038
Gene: ENSMUSG00000046191
AA Change: K608R

DomainStartEndE-ValueType
Pfam:Cadherin_2 30 112 8.3e-36 PFAM
low complexity region 136 148 N/A INTRINSIC
CA 155 240 1.41e-19 SMART
CA 264 345 2.91e-21 SMART
CA 368 449 1.12e-22 SMART
CA 473 559 3.41e-27 SMART
CA 589 670 6.34e-13 SMART
Pfam:Cadherin_C_2 686 769 7.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000059571
SMART Domains Protein: ENSMUSP00000053326
Gene: ENSMUSG00000043313

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
CA 45 131 4.8e-1 SMART
CA 155 240 6.58e-20 SMART
CA 264 345 1.03e-21 SMART
CA 368 449 4.21e-18 SMART
CA 473 559 3.36e-26 SMART
CA 589 670 6.69e-12 SMART
Pfam:Cadherin_C_2 686 769 1.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115661
SMART Domains Protein: ENSMUSP00000111325
Gene: ENSMUSG00000103458

DomainStartEndE-ValueType
CA 20 131 5.3e-2 SMART
CA 155 240 1.51e-19 SMART
CA 264 348 7.6e-25 SMART
CA 372 453 1.42e-24 SMART
CA 477 563 1.42e-24 SMART
CA 594 674 4.12e-12 SMART
low complexity region 706 721 N/A INTRINSIC
Pfam:Cadherin_tail 796 930 3.9e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000193984
Predicted Effect probably benign
Transcript: ENSMUST00000194544
SMART Domains Protein: ENSMUSP00000141847
Gene: ENSMUSG00000102836

DomainStartEndE-ValueType
Blast:CA 18 66 5e-20 BLAST
Meta Mutation Damage Score 0.1105 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.1%
Validation Efficiency 100% (79/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the protocadherin beta gene cluster, one of three related gene clusters tandemly linked on chromosome five. The gene clusters demonstrate an unusual genomic organization similar to that of B-cell and T-cell receptor gene clusters. The beta cluster contains 16 genes and 3 pseudogenes, each encoding 6 extracellular cadherin domains and a cytoplasmic tail that deviates from others in the cadherin superfamily. The extracellular domains interact in a homophilic manner to specify differential cell-cell connections. Unlike the alpha and gamma clusters, the transcripts from these genes are made up of only one large exon, not sharing common 3' exons as expected. These neural cadherin-like cell adhesion proteins are integral plasma membrane proteins. Their specific functions are unknown but they most likely play a critical role in the establishment and function of specific cell-cell neural connections. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930402F06Rik C A 2: 35,376,297 M120I probably damaging Het
4933427D14Rik A T 11: 72,191,516 L328Q probably damaging Het
Adgrv1 A C 13: 81,561,585 probably null Het
Ankrd46 A T 15: 36,484,133 probably benign Het
Arhgef18 A T 8: 3,444,979 M413L probably benign Het
Atp6v1e1 G A 6: 120,804,083 T87M probably null Het
Bap1 T C 14: 31,258,445 probably benign Het
Brf1 A G 12: 112,965,887 L385P probably benign Het
C1qtnf1 A T 11: 118,448,112 N203Y probably damaging Het
Catsperb A T 12: 101,602,766 N899I probably damaging Het
Ccnjl A C 11: 43,579,891 D162A probably damaging Het
Cd248 A C 19: 5,069,167 I348L probably benign Het
Cdc20 T C 4: 118,435,832 T265A probably benign Het
Cdca5 T A 19: 6,090,397 L196* probably null Het
Cdk4 T A 10: 127,064,575 probably benign Het
Cldn10 G A 14: 118,788,313 G53S possibly damaging Het
Clec4b2 G T 6: 123,201,040 E105* probably null Het
Dapk1 T A 13: 60,761,786 D1404E probably benign Het
Dnah1 T C 14: 31,267,539 Y3308C probably damaging Het
Dnah17 A C 11: 118,078,593 Y2260D probably damaging Het
Dock8 T G 19: 25,181,637 S1720A probably benign Het
Erc1 A G 6: 119,777,986 probably null Het
Ergic1 A G 17: 26,629,623 I66V probably benign Het
Fam186a T C 15: 99,945,277 T1029A possibly damaging Het
Fat4 A T 3: 38,980,632 Y2811F probably damaging Het
Flt3 A G 5: 147,369,300 M310T probably damaging Het
Ganab T A 19: 8,914,991 C844S probably benign Het
Gas2l2 C A 11: 83,429,215 V72F probably damaging Het
Gm14401 T A 2: 177,086,780 C220S probably damaging Het
Gm9745 T G 13: 8,940,601 probably benign Het
Hmmr A T 11: 40,728,434 V73E probably benign Het
Ifih1 G T 2: 62,635,014 probably benign Het
Jak3 A G 8: 71,685,404 E833G probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Ldb1 G A 19: 46,034,693 A217V probably benign Het
Lrrc8c A G 5: 105,608,089 T577A probably benign Het
Mfn1 T A 3: 32,546,562 probably benign Het
Mki67 G A 7: 135,696,745 P2187S probably damaging Het
Mrc1 T A 2: 14,319,141 D1096E probably benign Het
Msi1 A G 5: 115,435,595 probably benign Het
Msto1 T A 3: 88,912,252 I152F probably benign Het
Myo9a A G 9: 59,896,517 R2060G probably benign Het
Nnt A T 13: 119,404,571 C44* probably null Het
Nup210l A G 3: 90,193,071 D1468G probably damaging Het
Olfr1176 C A 2: 88,344,342 C129F possibly damaging Het
Olfr1257 A G 2: 89,881,132 E102G probably benign Het
Olfr19 T C 16: 16,673,618 D121G probably damaging Het
Olfr345 T C 2: 36,640,894 L285P probably damaging Het
P2rx3 G A 2: 85,024,926 T62I probably damaging Het
Pabpc4l G T 3: 46,447,143 T22K probably damaging Het
Pcdha7 A G 18: 36,975,593 D557G probably damaging Het
Pcnx A G 12: 81,918,165 S369G probably damaging Het
Plod1 T C 4: 147,920,279 I455V probably benign Het
Prune2 A T 19: 17,121,855 E1574D probably benign Het
Ptar1 T A 19: 23,703,108 L96H probably damaging Het
Rabgap1 T C 2: 37,560,571 S904P probably benign Het
Rps6ka4 C T 19: 6,838,099 V176I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Runx1t1 T A 4: 13,771,459 M1K probably null Het
Serinc4 T A 2: 121,452,424 Y419F probably damaging Het
Serpina12 A T 12: 104,037,797 M192K possibly damaging Het
Spata21 T A 4: 141,104,950 M474K probably damaging Het
Stpg1 T C 4: 135,519,365 S135P possibly damaging Het
Tdrkh A G 3: 94,429,364 D481G probably damaging Het
Ube2e1 A C 14: 18,285,268 S68R probably damaging Het
Vcpip1 A C 1: 9,747,347 N270K probably damaging Het
Vmn2r79 T C 7: 87,001,467 F154L probably benign Het
Vwa3b A G 1: 37,114,603 probably benign Het
Xdh C A 17: 73,900,708 V885L probably benign Het
Zfp141 A T 7: 42,476,205 V281D probably benign Het
Zfp317 T A 9: 19,646,847 I119N probably benign Het
Zfp345 G A 2: 150,472,688 R310C probably benign Het
Zfp760 G A 17: 21,723,248 C468Y probably benign Het
Other mutations in Pcdhb20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01071:Pcdhb20 APN 18 37504685 missense possibly damaging 0.87
IGL01373:Pcdhb20 APN 18 37506568 missense probably benign 0.10
IGL01556:Pcdhb20 APN 18 37504799 missense possibly damaging 0.88
IGL01621:Pcdhb20 APN 18 37504807 missense possibly damaging 0.49
IGL01768:Pcdhb20 APN 18 37506715 missense possibly damaging 0.80
IGL01859:Pcdhb20 APN 18 37504563 missense probably damaging 0.98
IGL02492:Pcdhb20 APN 18 37506400 missense probably benign 0.43
IGL03057:Pcdhb20 APN 18 37504798 missense possibly damaging 0.74
IGL02991:Pcdhb20 UTSW 18 37506211 missense probably damaging 1.00
R0799:Pcdhb20 UTSW 18 37505885 missense probably damaging 1.00
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R1465:Pcdhb20 UTSW 18 37504697 missense probably damaging 0.99
R2012:Pcdhb20 UTSW 18 37505074 missense probably damaging 0.99
R2079:Pcdhb20 UTSW 18 37505171 missense probably benign 0.07
R2350:Pcdhb20 UTSW 18 37504510 missense probably benign 0.01
R2363:Pcdhb20 UTSW 18 37505672 missense probably damaging 1.00
R2364:Pcdhb20 UTSW 18 37505938 missense probably damaging 1.00
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R2870:Pcdhb20 UTSW 18 37505780 missense possibly damaging 0.82
R4060:Pcdhb20 UTSW 18 37506164 missense probably damaging 1.00
R4609:Pcdhb20 UTSW 18 37505796 missense probably benign 0.02
R4750:Pcdhb20 UTSW 18 37506131 missense possibly damaging 0.48
R4970:Pcdhb20 UTSW 18 37506771 missense probably benign 0.00
R5098:Pcdhb20 UTSW 18 37504805 missense probably damaging 1.00
R5616:Pcdhb20 UTSW 18 37504532 missense probably damaging 0.97
R5890:Pcdhb20 UTSW 18 37505233 missense probably benign 0.00
R6225:Pcdhb20 UTSW 18 37504994 missense probably damaging 1.00
R6248:Pcdhb20 UTSW 18 37506232 missense probably damaging 0.99
R6419:Pcdhb20 UTSW 18 37505555 missense probably damaging 1.00
R6814:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R6821:Pcdhb20 UTSW 18 37506122 missense probably damaging 1.00
R6824:Pcdhb20 UTSW 18 37505699 missense probably benign 0.06
R6872:Pcdhb20 UTSW 18 37506165 missense probably benign 0.22
R7040:Pcdhb20 UTSW 18 37504717 missense probably benign 0.00
R7145:Pcdhb20 UTSW 18 37505089 missense probably damaging 1.00
R7165:Pcdhb20 UTSW 18 37505070 missense probably damaging 1.00
R7215:Pcdhb20 UTSW 18 37505386 missense probably benign 0.24
R7265:Pcdhb20 UTSW 18 37505563 missense possibly damaging 0.95
R7372:Pcdhb20 UTSW 18 37506787 missense probably benign 0.00
R7402:Pcdhb20 UTSW 18 37504952 missense probably benign 0.05
R7718:Pcdhb20 UTSW 18 37505651 missense probably damaging 1.00
R7794:Pcdhb20 UTSW 18 37504432 missense probably benign 0.00
R7842:Pcdhb20 UTSW 18 37505059 missense possibly damaging 0.94
R7925:Pcdhb20 UTSW 18 37505059 missense possibly damaging 0.94
R8084:Pcdhb20 UTSW 18 37506173 missense possibly damaging 0.95
R8133:Pcdhb20 UTSW 18 37506610 nonsense probably null
Z1177:Pcdhb20 UTSW 18 37504588 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- GACGACAATGACAATGCGCC -3'
(R):5'- ACATCTTCTTCTTGTGCAGGG -3'

Sequencing Primer
(F):5'- AATGACAATGCGCCCTTCGTG -3'
(R):5'- GCTGAGAGAAGCCATCCAC -3'
Genotyping

Genotyping is performed by amplifying the region containing the mutation using PCR, followed by sequencing of the amplified region to detect the mutation.

 

NOTE: The PCR primers for this reaction have been updated. The HiSeq PCR primers did not work.
 

PCR Primers

R48970072_PCR_F: 5’- GCTGACAACGGGCAGCTATT-3’

R48970072_PCR_R: 5’- TGGGCATGACCGGCCTAA-3’

 

Sequencing Primers

R48970072_SEQ_F: 5’- AATGACAATGCGCCCTTCGTG-3’
 

R48970072_SEQ_R: 5’- GCTGAGAGAAGCCATCCAC-3’
 

 

PCR program

1) 94°C             2:00

2) 94°C             0:30

3) 55°C             0:30

4) 72°C             1:00

5) repeat steps (2-4) 40X

6) 72°C             10:00

7) 4°C               hold

 

The following sequence of 799 nucleotides is amplified (Chr. 18: 37505944-37506742; NCBI RefSeq: NC_000084):

 

gctgacaacg ggcagctatt tgcgctcagg gcgctggact atgaggtcct gcaggccttc
gagttccaag tgggtgcgac agaccgaggc tcgcccgcac tcagcagcca gactctggtg
cgcgtggtag tgctggacga caatgacaat gcgcccttcg tgctctaccc gatgcagaac
gcctctgcgc cttgcactga gctgctgccc agggtggcag aacctggcta cctggtcacc
aaagtagtgg ctgtggatcg cgactctggc cagaatgcct ggctgtcgtt ccagctgctc
aaggctacag agccagggct gttcagcgtg tgggcgcaca atggcgaggt acgcactacc
aggctgctga gcgagcgcga tgtgcccaag cacaggctgg tactgctagt caaggacaat
ggcgatcctc cgcgctctgc cagcgtcacg ctgcacgtgc tagtggtgga tggcttctct
cagccctacc tgcctctgcc agaggtggcg cgcgaccctg cacaagaaga agatgtacta
acactctacc tggtcatagc cttggcatct gtgtcttctc tcttcctctt gtctgtgctg
ctgtttgtgg gggtgaggct gtgcaggagg gccagggctg cctctctggg tggctgctct
gtgcctgagg gacactttcc tggccatctg gtggacgtta ctggcactgg aaccctgtcc
cagaactacc aatatgaggt gtgtttcaca ggaggtactg gaacgaatga gttcaaattc
cttaggccgg tcatgccca

 

Primer binding sites are underlined and the sequencing primer is highlighted; the mutated nucleotide is shown in red text (Chr. (+) = A>G).

Posted On2016-03-17