Incidental Mutation 'R4898:Arfgef1'
ID375856
Institutional Source Beutler Lab
Gene Symbol Arfgef1
Ensembl Gene ENSMUSG00000067851
Gene NameADP-ribosylation factor guanine nucleotide-exchange factor 1(brefeldin A-inhibited)
SynonymsP200, ARFGEP1, BIG1, D130059B05Rik, D730028O18Rik
MMRRC Submission 042502-MU
Accession Numbers

Genbank: NM_001102430.1

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4898 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location10137571-10232670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10159573 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 1301 (I1301T)
Ref Sequence ENSEMBL: ENSMUSP00000085986 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088615]
Predicted Effect possibly damaging
Transcript: ENSMUST00000088615
AA Change: I1301T

PolyPhen 2 Score 0.747 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000085986
Gene: ENSMUSG00000067851
AA Change: I1301T

DomainStartEndE-ValueType
Pfam:DCB 28 213 5.2e-45 PFAM
low complexity region 221 233 N/A INTRINSIC
low complexity region 291 306 N/A INTRINSIC
Pfam:Sec7_N 416 575 1.3e-52 PFAM
Blast:Sec7 588 637 6e-24 BLAST
low complexity region 661 681 N/A INTRINSIC
Sec7 692 879 1.15e-105 SMART
Blast:Sec7 897 933 6e-13 BLAST
Blast:Sec7 947 986 8e-18 BLAST
Pfam:DUF1981 1217 1300 3.6e-39 PFAM
low complexity region 1587 1602 N/A INTRINSIC
low complexity region 1777 1782 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156563
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ADP-ribosylation factors (ARFs) play an important role in intracellular vesicular trafficking. The protein encoded by this gene is involved in the activation of ARFs by accelerating replacement of bound GDP with GTP. It contains a Sec7 domain, which may be responsible for guanine-nucleotide exchange activity and also brefeldin A inhibition. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality, absent gastric milk and decreased brain size with increased neuron apoptosis, abnormal axon guidance and hypersensitivity to glutamate. [provided by MGI curators]
Allele List at MGI

All alleles(10) : Gene trapped(10)

Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,989,687 Y944C probably damaging Het
Acacb T C 5: 114,232,938 V1747A probably benign Het
Acad8 C T 9: 26,978,402 R332H probably damaging Het
Acrbp A C 6: 125,050,538 T50P probably damaging Het
Ahctf1 G T 1: 179,755,512 N1500K probably benign Het
Arhgef15 T C 11: 68,951,345 S478G probably benign Het
Armh1 T C 4: 117,237,780 D21G probably damaging Het
Atp13a4 A T 16: 29,408,961 L1045* probably null Het
Atp2a3 T A 11: 72,982,680 L793H probably damaging Het
B4galnt4 C A 7: 141,068,260 P563Q probably benign Het
BC027072 A G 17: 71,751,071 M537T probably damaging Het
Bcl2a1b A T 9: 89,199,660 K94* probably null Het
Bod1 T A 11: 31,666,853 Q136L possibly damaging Het
C2cd3 A G 7: 100,405,959 K443R probably damaging Het
Cadps A G 14: 12,411,588 V1250A possibly damaging Het
Car12 T A 9: 66,764,318 Y332* probably null Het
Ccdc186 A T 19: 56,802,000 probably null Het
Cdh6 T C 15: 13,034,688 T629A probably damaging Het
Cep112 T A 11: 108,506,645 D353E probably damaging Het
Cep152 T C 2: 125,586,381 S777G probably benign Het
Clec4b2 A C 6: 123,204,204 K183Q probably benign Het
Cngb3 T C 4: 19,395,926 Y323H probably benign Het
Cnp G T 11: 100,576,376 E48D probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp2d11 T A 15: 82,391,023 D241V probably benign Het
D5Ertd579e T A 5: 36,614,941 E703D probably damaging Het
Dlg1 T C 16: 31,857,946 V731A probably damaging Het
Dlgap5 T C 14: 47,413,819 S86G probably benign Het
Dock3 A G 9: 106,930,067 F1354L probably damaging Het
Dock3 C A 9: 106,992,972 V638F possibly damaging Het
E130309D02Rik A G 5: 143,301,837 S438P probably benign Het
Eif3c A T 7: 126,557,454 M407K probably benign Het
Epha4 T A 1: 77,390,075 K578* probably null Het
Erc2 C T 14: 27,653,328 L168F probably damaging Het
Esyt2 A G 12: 116,342,088 I313V probably benign Het
Far1 T A 7: 113,568,225 Y506N probably damaging Het
Fbxw26 T A 9: 109,717,969 N463Y possibly damaging Het
Fgg A G 3: 83,008,540 D96G probably benign Het
Gfer A G 17: 24,695,300 S130P probably damaging Het
Gm8994 A T 6: 136,328,739 Q66L possibly damaging Het
Hdac10 A T 15: 89,128,447 M1K probably null Het
Hsd3b1 A T 3: 98,853,326 S110R probably benign Het
Itga6 T C 2: 71,838,373 L552P possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc8a A G 2: 30,257,202 K676R probably benign Het
Lrrc8b A T 5: 105,480,214 Y142F probably benign Het
Lyz2 T A 10: 117,278,709 D105V possibly damaging Het
Mamdc4 T C 2: 25,570,023 D76G probably damaging Het
Map7d1 T C 4: 126,233,225 K731E unknown Het
Mgam A C 6: 40,643,054 I26L probably benign Het
Mmp13 A T 9: 7,272,953 E104D probably benign Het
Morc2a C T 11: 3,676,664 R241* probably null Het
Mtfmt C A 9: 65,452,104 H354N probably benign Het
Myh3 T C 11: 67,099,407 I1626T probably benign Het
Ndst1 A T 18: 60,691,987 V753D probably benign Het
Neurl4 A G 11: 69,903,171 D151G probably damaging Het
Nlrx1 T C 9: 44,256,897 S568G probably benign Het
Olfr1263 T C 2: 90,015,418 F163L probably damaging Het
Olfr1513 G C 14: 52,349,542 P168R probably damaging Het
Olfr315 T C 11: 58,778,306 Y60H possibly damaging Het
Olfr325 T G 11: 58,581,720 L292R probably damaging Het
Olfr593 A G 7: 103,212,540 I216V probably damaging Het
Olfr798 A T 10: 129,625,599 I154N probably benign Het
Olfr901 A T 9: 38,430,815 M178L probably benign Het
Osbpl7 A G 11: 97,060,150 I608V probably damaging Het
Pard3b T C 1: 61,768,000 I58T probably damaging Het
Pcdhga1 A C 18: 37,662,354 E137A possibly damaging Het
Pde6c G A 19: 38,150,624 V301I possibly damaging Het
Pdia5 G C 16: 35,410,416 N338K possibly damaging Het
Pex11g T C 8: 3,464,042 Y40C probably damaging Het
Plekhg3 A G 12: 76,564,125 Y183C probably damaging Het
Pole A C 5: 110,290,224 probably null Het
Ppfia1 A G 7: 144,491,576 L948P probably damaging Het
Prdm2 A T 4: 143,134,191 V843E probably damaging Het
Prss56 C A 1: 87,187,986 F527L probably damaging Het
Psmd11 T C 11: 80,438,320 L88P probably damaging Het
Ptx3 G C 3: 66,224,991 G311A probably damaging Het
Rars A T 11: 35,808,558 L636H probably damaging Het
Rnft2 A G 5: 118,237,442 S81P probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxra T A 2: 27,741,183 I142N probably damaging Het
Scin T C 12: 40,104,932 M221V probably benign Het
Sfmbt2 G A 2: 10,579,258 V809I possibly damaging Het
Sirt1 T A 10: 63,322,004 I505F probably benign Het
Six5 T C 7: 19,095,171 Y179H probably damaging Het
Slc12a4 A C 8: 105,944,609 M982R probably damaging Het
Slco4c1 T A 1: 96,837,512 L404F probably damaging Het
Smn1 T C 13: 100,132,423 L259P probably damaging Het
Sorl1 T G 9: 42,041,639 D702A probably damaging Het
Spta1 A G 1: 174,237,834 E1983G possibly damaging Het
Srsf1 T A 11: 88,049,962 probably null Het
Stard9 C T 2: 120,706,419 R4224* probably null Het
Svs1 A G 6: 48,987,717 T220A possibly damaging Het
Sybu T G 15: 44,675,499 M383L probably benign Het
Tbx15 A C 3: 99,352,267 N485H possibly damaging Het
Tcerg1l A T 7: 138,218,057 F485I probably damaging Het
Tdrd7 C A 4: 46,005,616 T474N possibly damaging Het
Thada A T 17: 84,448,042 probably null Het
Tnik A T 3: 28,650,086 I1020F probably damaging Het
Tnxb A G 17: 34,695,592 D1884G possibly damaging Het
Tprn T C 2: 25,268,833 M623T probably damaging Het
Trdn T A 10: 33,474,417 Y661N probably damaging Het
Ttc41 T C 10: 86,776,192 S1110P possibly damaging Het
Ttc6 A C 12: 57,660,240 R644S probably benign Het
Ttyh1 A T 7: 4,133,736 M448L probably benign Het
Unc79 G T 12: 103,161,820 C2250F probably damaging Het
Ush2a A G 1: 188,626,608 I2110M probably benign Het
Uvssa G T 5: 33,413,913 E634* probably null Het
Vac14 A C 8: 110,645,808 T384P probably benign Het
Wdr11 A G 7: 129,633,721 E1169G probably benign Het
Zfp36l1 T A 12: 80,110,524 T28S probably benign Het
Zfp715 A T 7: 43,299,682 Y285N possibly damaging Het
Zfp91 A T 19: 12,770,060 D566E probably damaging Het
Zgrf1 G A 3: 127,602,436 V544M probably damaging Het
Other mutations in Arfgef1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00766:Arfgef1 APN 1 10199787 missense probably benign
IGL00919:Arfgef1 APN 1 10173237 missense probably damaging 1.00
IGL01022:Arfgef1 APN 1 10174076 missense probably damaging 1.00
IGL01155:Arfgef1 APN 1 10198982 splice site probably benign
IGL01288:Arfgef1 APN 1 10213211 missense possibly damaging 0.67
IGL01397:Arfgef1 APN 1 10159571 missense probably benign 0.40
IGL01433:Arfgef1 APN 1 10153432 missense probably damaging 1.00
IGL01653:Arfgef1 APN 1 10159908 nonsense probably null
IGL01669:Arfgef1 APN 1 10159615 missense probably damaging 1.00
IGL01795:Arfgef1 APN 1 10147528 missense probably benign 0.01
IGL01860:Arfgef1 APN 1 10154396 missense probably damaging 1.00
IGL02137:Arfgef1 APN 1 10213113 missense probably damaging 1.00
IGL02365:Arfgef1 APN 1 10199883 missense probably benign 0.00
IGL02519:Arfgef1 APN 1 10209668 missense probably benign 0.13
IGL02542:Arfgef1 APN 1 10172842 missense probably benign 0.24
IGL02604:Arfgef1 APN 1 10181050 splice site probably benign
IGL02743:Arfgef1 APN 1 10199829 missense probably benign 0.00
IGL03225:Arfgef1 APN 1 10154318 missense probably damaging 1.00
Collected UTSW 1 10180938 missense probably damaging 1.00
uncle_joe UTSW 1 10160835 missense probably damaging 1.00
I2288:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
I2289:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
R0383:Arfgef1 UTSW 1 10198842 critical splice donor site probably null
R0491:Arfgef1 UTSW 1 10179987 splice site probably benign
R0636:Arfgef1 UTSW 1 10199851 missense probably benign
R1006:Arfgef1 UTSW 1 10140481 missense probably benign 0.00
R1212:Arfgef1 UTSW 1 10216559 missense probably benign 0.05
R1233:Arfgef1 UTSW 1 10184090 missense probably damaging 1.00
R1346:Arfgef1 UTSW 1 10159733 missense probably benign 0.41
R1416:Arfgef1 UTSW 1 10172939 missense probably damaging 1.00
R1477:Arfgef1 UTSW 1 10189284 missense probably damaging 1.00
R1581:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1587:Arfgef1 UTSW 1 10159959 missense probably damaging 0.99
R1602:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1745:Arfgef1 UTSW 1 10173255 missense probably damaging 1.00
R1831:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1832:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1833:Arfgef1 UTSW 1 10204890 missense probably benign 0.01
R1918:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R1919:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2059:Arfgef1 UTSW 1 10188752 splice site probably null
R2146:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2148:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2149:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2150:Arfgef1 UTSW 1 10199878 missense probably benign 0.02
R2373:Arfgef1 UTSW 1 10174142 missense probably damaging 1.00
R2516:Arfgef1 UTSW 1 10153654 missense possibly damaging 0.89
R3863:Arfgef1 UTSW 1 10142586 frame shift probably null
R3916:Arfgef1 UTSW 1 10189443 missense probably benign 0.01
R3948:Arfgef1 UTSW 1 10142586 frame shift probably null
R3949:Arfgef1 UTSW 1 10142586 frame shift probably null
R3977:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3978:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R3979:Arfgef1 UTSW 1 10209634 missense probably benign 0.01
R4086:Arfgef1 UTSW 1 10163759 missense probably benign 0.06
R4175:Arfgef1 UTSW 1 10159636 missense probably damaging 1.00
R4257:Arfgef1 UTSW 1 10159546 intron probably benign
R4572:Arfgef1 UTSW 1 10213141 missense probably damaging 1.00
R4652:Arfgef1 UTSW 1 10173262 missense probably damaging 0.98
R4678:Arfgef1 UTSW 1 10142666 missense probably benign 0.03
R4737:Arfgef1 UTSW 1 10189611 missense possibly damaging 0.85
R4779:Arfgef1 UTSW 1 10153733 missense probably damaging 1.00
R4818:Arfgef1 UTSW 1 10216547 missense probably benign
R4979:Arfgef1 UTSW 1 10213109 missense probably damaging 1.00
R5039:Arfgef1 UTSW 1 10199736 missense probably benign 0.37
R5194:Arfgef1 UTSW 1 10204907 missense probably benign 0.09
R5428:Arfgef1 UTSW 1 10160835 missense probably damaging 1.00
R5533:Arfgef1 UTSW 1 10199727 critical splice donor site probably null
R5547:Arfgef1 UTSW 1 10160976 missense probably damaging 1.00
R5562:Arfgef1 UTSW 1 10144746 missense probably damaging 1.00
R5635:Arfgef1 UTSW 1 10188860 missense possibly damaging 0.81
R5697:Arfgef1 UTSW 1 10160838 missense probably benign 0.03
R5704:Arfgef1 UTSW 1 10159583 missense probably damaging 0.98
R5722:Arfgef1 UTSW 1 10138884 missense probably benign 0.04
R5793:Arfgef1 UTSW 1 10209528 missense probably benign 0.01
R5835:Arfgef1 UTSW 1 10160739 missense probably damaging 1.00
R5870:Arfgef1 UTSW 1 10180938 missense probably damaging 1.00
R5990:Arfgef1 UTSW 1 10172921 missense probably damaging 0.99
R6290:Arfgef1 UTSW 1 10188811 missense possibly damaging 0.91
R6460:Arfgef1 UTSW 1 10213060 missense probably damaging 1.00
R6613:Arfgef1 UTSW 1 10194396 missense possibly damaging 0.95
R6802:Arfgef1 UTSW 1 10189452 missense probably benign 0.35
R6967:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6967:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6968:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6968:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6969:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6969:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R6970:Arfgef1 UTSW 1 10153678 missense probably damaging 1.00
R6970:Arfgef1 UTSW 1 10153679 missense probably damaging 0.99
R7092:Arfgef1 UTSW 1 10153676 missense probably damaging 1.00
R7251:Arfgef1 UTSW 1 10198975 missense possibly damaging 0.81
R7334:Arfgef1 UTSW 1 10184460 missense probably damaging 1.00
R7399:Arfgef1 UTSW 1 10180897 missense probably benign 0.00
R7631:Arfgef1 UTSW 1 10232469 missense probably benign 0.00
R7699:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7700:Arfgef1 UTSW 1 10194411 missense possibly damaging 0.78
R7772:Arfgef1 UTSW 1 10157010 missense possibly damaging 0.96
V1662:Arfgef1 UTSW 1 10173253 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTGCTGAAACTACTATTACAACA -3'
(R):5'- GTTCTATGCCAAGGGGAAAAGTA -3'

Sequencing Primer
(F):5'- CAGTCATAATCTTACTGCACC -3'
(R):5'- GAAAGAAATGGGTTGAGTTTTATGTG -3'
Posted On2016-03-17