Incidental Mutation 'R4898:Tbx15'
ID 375877
Institutional Source Beutler Lab
Gene Symbol Tbx15
Ensembl Gene ENSMUSG00000027868
Gene Name T-box 15
Synonyms Tbx8, de, Tbx14
MMRRC Submission 042502-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.931) question?
Stock # R4898 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 99147697-99261575 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 99259583 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Histidine at position 485 (N485H)
Ref Sequence ENSEMBL: ENSMUSP00000029462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029462]
AlphaFold O70306
Predicted Effect possibly damaging
Transcript: ENSMUST00000029462
AA Change: N485H

PolyPhen 2 Score 0.954 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029462
Gene: ENSMUSG00000027868
AA Change: N485H

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
TBOX 112 309 8.05e-131 SMART
Blast:TBOX 310 482 8e-83 BLAST
low complexity region 486 492 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the T-box family of genes, which encode a phylogenetically conserved family of transcription factors that regulate a variety of developmental processes. All these genes contain a common T-box DNA-binding domain. Mutations in this gene are associated with Cousin syndrome.[provided by RefSeq, Oct 2009]
PHENOTYPE: Homozygous mutants have low set ears that project laterally, skeletal abnormalities and distinctive dorsoventral coat color patterning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,639,111 (GRCm39) Y944C probably damaging Het
Acacb T C 5: 114,370,999 (GRCm39) V1747A probably benign Het
Acad8 C T 9: 26,889,698 (GRCm39) R332H probably damaging Het
Acrbp A C 6: 125,027,501 (GRCm39) T50P probably damaging Het
Ahctf1 G T 1: 179,583,077 (GRCm39) N1500K probably benign Het
Aoc1l3 A G 6: 48,964,651 (GRCm39) T220A possibly damaging Het
Arfgef1 A G 1: 10,229,798 (GRCm39) I1301T possibly damaging Het
Arhgef15 T C 11: 68,842,171 (GRCm39) S478G probably benign Het
Armh1 T C 4: 117,094,977 (GRCm39) D21G probably damaging Het
Atp13a4 A T 16: 29,227,779 (GRCm39) L1045* probably null Het
Atp2a3 T A 11: 72,873,506 (GRCm39) L793H probably damaging Het
B4galnt4 C A 7: 140,648,173 (GRCm39) P563Q probably benign Het
Bcl2a1b A T 9: 89,081,713 (GRCm39) K94* probably null Het
Bod1 T A 11: 31,616,853 (GRCm39) Q136L possibly damaging Het
C2cd3 A G 7: 100,055,166 (GRCm39) K443R probably damaging Het
Cadps A G 14: 12,411,588 (GRCm38) V1250A possibly damaging Het
Car12 T A 9: 66,671,600 (GRCm39) Y332* probably null Het
Ccdc186 A T 19: 56,790,432 (GRCm39) probably null Het
Cdh6 T C 15: 13,034,774 (GRCm39) T629A probably damaging Het
Cep112 T A 11: 108,397,471 (GRCm39) D353E probably damaging Het
Cep152 T C 2: 125,428,301 (GRCm39) S777G probably benign Het
Clec4b2 A C 6: 123,181,163 (GRCm39) K183Q probably benign Het
Cngb3 T C 4: 19,395,926 (GRCm39) Y323H probably benign Het
Cnp G T 11: 100,467,202 (GRCm39) E48D probably benign Het
Ctrb1 T A 8: 112,413,783 (GRCm39) I194F probably benign Het
Cyp2d11 T A 15: 82,275,224 (GRCm39) D241V probably benign Het
D5Ertd579e T A 5: 36,772,285 (GRCm39) E703D probably damaging Het
Dlg1 T C 16: 31,676,764 (GRCm39) V731A probably damaging Het
Dlgap5 T C 14: 47,651,276 (GRCm39) S86G probably benign Het
Dock3 A G 9: 106,807,266 (GRCm39) F1354L probably damaging Het
Dock3 C A 9: 106,870,171 (GRCm39) V638F possibly damaging Het
Eif3c A T 7: 126,156,626 (GRCm39) M407K probably benign Het
Eif4a3l1 A T 6: 136,305,737 (GRCm39) Q66L possibly damaging Het
Epha4 T A 1: 77,366,712 (GRCm39) K578* probably null Het
Erc2 C T 14: 27,375,285 (GRCm39) L168F probably damaging Het
Esyt2 A G 12: 116,305,708 (GRCm39) I313V probably benign Het
Far1 T A 7: 113,167,432 (GRCm39) Y506N probably damaging Het
Fbxw26 T A 9: 109,547,037 (GRCm39) N463Y possibly damaging Het
Fgg A G 3: 82,915,847 (GRCm39) D96G probably benign Het
Gfer A G 17: 24,914,274 (GRCm39) S130P probably damaging Het
Hdac10 A T 15: 89,012,650 (GRCm39) M1K probably null Het
Hsd3b1 A T 3: 98,760,642 (GRCm39) S110R probably benign Het
Ints15 A G 5: 143,287,592 (GRCm39) S438P probably benign Het
Itga6 T C 2: 71,668,717 (GRCm39) L552P possibly damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lama2 TTTGCGCATT TTT 10: 26,919,639 (GRCm39) probably null Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Lrrc8a A G 2: 30,147,214 (GRCm39) K676R probably benign Het
Lrrc8b A T 5: 105,628,080 (GRCm39) Y142F probably benign Het
Lyz2 T A 10: 117,114,614 (GRCm39) D105V possibly damaging Het
Mamdc4 T C 2: 25,460,035 (GRCm39) D76G probably damaging Het
Map7d1 T C 4: 126,127,018 (GRCm39) K731E unknown Het
Mgam A C 6: 40,619,988 (GRCm39) I26L probably benign Het
Mmp13 A T 9: 7,272,953 (GRCm39) E104D probably benign Het
Morc2a C T 11: 3,626,664 (GRCm39) R241* probably null Het
Mtfmt C A 9: 65,359,386 (GRCm39) H354N probably benign Het
Myh3 T C 11: 66,990,233 (GRCm39) I1626T probably benign Het
Ndst1 A T 18: 60,825,059 (GRCm39) V753D probably benign Het
Neurl4 A G 11: 69,793,997 (GRCm39) D151G probably damaging Het
Nlrx1 T C 9: 44,168,194 (GRCm39) S568G probably benign Het
Or10g3b G C 14: 52,586,999 (GRCm39) P168R probably damaging Het
Or2t45 T C 11: 58,669,132 (GRCm39) Y60H possibly damaging Het
Or2t46 T G 11: 58,472,546 (GRCm39) L292R probably damaging Het
Or4c52 T C 2: 89,845,762 (GRCm39) F163L probably damaging Het
Or52s1 A G 7: 102,861,747 (GRCm39) I216V probably damaging Het
Or6c66 A T 10: 129,461,468 (GRCm39) I154N probably benign Het
Or8b42 A T 9: 38,342,111 (GRCm39) M178L probably benign Het
Osbpl7 A G 11: 96,950,976 (GRCm39) I608V probably damaging Het
Pard3b T C 1: 61,807,159 (GRCm39) I58T probably damaging Het
Pcare A G 17: 72,058,066 (GRCm39) M537T probably damaging Het
Pcdhga1 A C 18: 37,795,407 (GRCm39) E137A possibly damaging Het
Pde6c G A 19: 38,139,072 (GRCm39) V301I possibly damaging Het
Pdia5 G C 16: 35,230,786 (GRCm39) N338K possibly damaging Het
Pex11g T C 8: 3,514,042 (GRCm39) Y40C probably damaging Het
Plekhg3 A G 12: 76,610,899 (GRCm39) Y183C probably damaging Het
Pole A C 5: 110,438,090 (GRCm39) probably null Het
Ppfia1 A G 7: 144,045,313 (GRCm39) L948P probably damaging Het
Prdm2 A T 4: 142,860,761 (GRCm39) V843E probably damaging Het
Prss56 C A 1: 87,115,708 (GRCm39) F527L probably damaging Het
Psmd11 T C 11: 80,329,146 (GRCm39) L88P probably damaging Het
Ptx3 G C 3: 66,132,412 (GRCm39) G311A probably damaging Het
Rars1 A T 11: 35,699,385 (GRCm39) L636H probably damaging Het
Rnft2 A G 5: 118,375,507 (GRCm39) S81P probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Rxra T A 2: 27,631,195 (GRCm39) I142N probably damaging Het
Scin T C 12: 40,154,931 (GRCm39) M221V probably benign Het
Sfmbt2 G A 2: 10,584,069 (GRCm39) V809I possibly damaging Het
Sirt1 T A 10: 63,157,783 (GRCm39) I505F probably benign Het
Six5 T C 7: 18,829,096 (GRCm39) Y179H probably damaging Het
Slc12a4 A C 8: 106,671,241 (GRCm39) M982R probably damaging Het
Slco4c1 T A 1: 96,765,237 (GRCm39) L404F probably damaging Het
Smn1 T C 13: 100,268,931 (GRCm39) L259P probably damaging Het
Sorl1 T G 9: 41,952,935 (GRCm39) D702A probably damaging Het
Spta1 A G 1: 174,065,400 (GRCm39) E1983G possibly damaging Het
Srsf1 T A 11: 87,940,788 (GRCm39) probably null Het
Stard9 C T 2: 120,536,900 (GRCm39) R4224* probably null Het
Sybu T G 15: 44,538,895 (GRCm39) M383L probably benign Het
Tcerg1l A T 7: 137,819,786 (GRCm39) F485I probably damaging Het
Tdrd7 C A 4: 46,005,616 (GRCm39) T474N possibly damaging Het
Thada A T 17: 84,755,470 (GRCm39) probably null Het
Tnik A T 3: 28,704,235 (GRCm39) I1020F probably damaging Het
Tnxb A G 17: 34,914,566 (GRCm39) D1884G possibly damaging Het
Tprn T C 2: 25,158,845 (GRCm39) M623T probably damaging Het
Trdn T A 10: 33,350,413 (GRCm39) Y661N probably damaging Het
Ttc41 T C 10: 86,612,056 (GRCm39) S1110P possibly damaging Het
Ttc6 A C 12: 57,707,026 (GRCm39) R644S probably benign Het
Ttyh1 A T 7: 4,136,735 (GRCm39) M448L probably benign Het
Unc79 G T 12: 103,128,079 (GRCm39) C2250F probably damaging Het
Ush2a A G 1: 188,358,805 (GRCm39) I2110M probably benign Het
Uvssa G T 5: 33,571,257 (GRCm39) E634* probably null Het
Vac14 A C 8: 111,372,440 (GRCm39) T384P probably benign Het
Wdr11 A G 7: 129,235,445 (GRCm39) E1169G probably benign Het
Zfp36l1 T A 12: 80,157,298 (GRCm39) T28S probably benign Het
Zfp715 A T 7: 42,949,106 (GRCm39) Y285N possibly damaging Het
Zfp91 A T 19: 12,747,424 (GRCm39) D566E probably damaging Het
Zgrf1 G A 3: 127,396,085 (GRCm39) V544M probably damaging Het
Other mutations in Tbx15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01024:Tbx15 APN 3 99,223,562 (GRCm39) missense probably damaging 1.00
IGL01458:Tbx15 APN 3 99,223,544 (GRCm39) missense probably damaging 0.98
IGL01633:Tbx15 APN 3 99,220,358 (GRCm39) missense probably damaging 0.97
IGL02338:Tbx15 APN 3 99,259,800 (GRCm39) missense probably damaging 1.00
IGL02415:Tbx15 APN 3 99,259,826 (GRCm39) missense probably benign 0.01
IGL03143:Tbx15 APN 3 99,259,514 (GRCm39) missense possibly damaging 0.67
IGL03201:Tbx15 APN 3 99,259,296 (GRCm39) missense probably benign 0.00
shin_guard UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
Shortcut UTSW 3 99,220,389 (GRCm39) nonsense probably null
R0012:Tbx15 UTSW 3 99,259,412 (GRCm39) missense probably benign
R0109:Tbx15 UTSW 3 99,259,182 (GRCm39) missense possibly damaging 0.92
R0277:Tbx15 UTSW 3 99,259,707 (GRCm39) missense probably damaging 1.00
R0462:Tbx15 UTSW 3 99,223,634 (GRCm39) missense probably damaging 1.00
R1134:Tbx15 UTSW 3 99,223,639 (GRCm39) missense probably damaging 0.98
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1347:Tbx15 UTSW 3 99,259,427 (GRCm39) missense possibly damaging 0.92
R1506:Tbx15 UTSW 3 99,259,228 (GRCm39) missense possibly damaging 0.80
R1681:Tbx15 UTSW 3 99,259,140 (GRCm39) splice site probably null
R1762:Tbx15 UTSW 3 99,259,260 (GRCm39) nonsense probably null
R1789:Tbx15 UTSW 3 99,259,562 (GRCm39) nonsense probably null
R2167:Tbx15 UTSW 3 99,233,771 (GRCm39) splice site probably benign
R2254:Tbx15 UTSW 3 99,259,190 (GRCm39) missense possibly damaging 0.52
R2357:Tbx15 UTSW 3 99,223,672 (GRCm39) splice site probably null
R2441:Tbx15 UTSW 3 99,259,827 (GRCm39) missense probably damaging 0.99
R3010:Tbx15 UTSW 3 99,161,209 (GRCm39) intron probably benign
R3118:Tbx15 UTSW 3 99,259,470 (GRCm39) missense probably damaging 0.96
R4081:Tbx15 UTSW 3 99,220,370 (GRCm39) missense possibly damaging 0.92
R4610:Tbx15 UTSW 3 99,259,683 (GRCm39) missense probably damaging 1.00
R4950:Tbx15 UTSW 3 99,233,700 (GRCm39) missense possibly damaging 0.82
R4982:Tbx15 UTSW 3 99,161,390 (GRCm39) missense probably benign 0.06
R4999:Tbx15 UTSW 3 99,223,649 (GRCm39) missense probably damaging 1.00
R5236:Tbx15 UTSW 3 99,259,362 (GRCm39) missense possibly damaging 0.92
R5339:Tbx15 UTSW 3 99,223,600 (GRCm39) missense possibly damaging 0.61
R5364:Tbx15 UTSW 3 99,259,508 (GRCm39) missense possibly damaging 0.90
R5493:Tbx15 UTSW 3 99,259,880 (GRCm39) missense probably benign
R5690:Tbx15 UTSW 3 99,216,166 (GRCm39) missense probably damaging 0.99
R5756:Tbx15 UTSW 3 99,220,402 (GRCm39) missense probably damaging 1.00
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6032:Tbx15 UTSW 3 99,259,833 (GRCm39) missense probably benign 0.28
R6156:Tbx15 UTSW 3 99,220,431 (GRCm39) critical splice donor site probably null
R6173:Tbx15 UTSW 3 99,161,203 (GRCm39) nonsense probably null
R6596:Tbx15 UTSW 3 99,259,508 (GRCm39) missense probably benign
R6680:Tbx15 UTSW 3 99,220,389 (GRCm39) nonsense probably null
R6931:Tbx15 UTSW 3 99,259,467 (GRCm39) missense probably damaging 1.00
R8129:Tbx15 UTSW 3 99,161,254 (GRCm39) missense probably damaging 1.00
R8155:Tbx15 UTSW 3 99,259,886 (GRCm39) missense possibly damaging 0.69
R8230:Tbx15 UTSW 3 99,259,305 (GRCm39) missense probably damaging 1.00
R8729:Tbx15 UTSW 3 99,220,376 (GRCm39) missense possibly damaging 0.90
R8929:Tbx15 UTSW 3 99,222,219 (GRCm39) missense probably damaging 1.00
R9038:Tbx15 UTSW 3 99,222,085 (GRCm39) missense probably benign 0.14
R9688:Tbx15 UTSW 3 99,233,708 (GRCm39) missense possibly damaging 0.89
R9746:Tbx15 UTSW 3 99,259,647 (GRCm39) missense probably damaging 1.00
X0023:Tbx15 UTSW 3 99,222,151 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCTTACAGAGCTATCCAGG -3'
(R):5'- AAGTGCTTTGAGACGCGCTC -3'

Sequencing Primer
(F):5'- CTTACAGAGCTATCCAGGGCTGAG -3'
(R):5'- GAGACGCGCTCAGTTTCTCTG -3'
Posted On 2016-03-17