Incidental Mutation 'R4898:Acacb'
ID 375889
Institutional Source Beutler Lab
Gene Symbol Acacb
Ensembl Gene ENSMUSG00000042010
Gene Name acetyl-Coenzyme A carboxylase beta
Synonyms Acc2, Accb
MMRRC Submission 042502-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4898 (G1)
Quality Score 225
Status Not validated
Chromosome 5
Chromosomal Location 114284748-114388822 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 114370999 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 1747 (V1747A)
Ref Sequence ENSEMBL: ENSMUSP00000099642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]
AlphaFold E9Q4Z2
Predicted Effect probably benign
Transcript: ENSMUST00000031583
AA Change: V1747A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: V1747A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 2.1e-32 PFAM
Pfam:CPSase_L_D2 405 606 3.3e-52 PFAM
Pfam:ATP-grasp_4 413 576 2.1e-9 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 1.9e-17 PFAM
Pfam:ACC_central 952 1678 2.2e-290 PFAM
Pfam:Carboxyl_trans 1770 2324 2.3e-181 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000102582
AA Change: V1747A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: V1747A

DomainStartEndE-ValueType
signal peptide 1 16 N/A INTRINSIC
low complexity region 38 60 N/A INTRINSIC
Pfam:CPSase_L_chain 249 369 8.2e-29 PFAM
Pfam:CPSase_L_D2 405 606 3.8e-52 PFAM
Pfam:ATP-grasp_4 409 576 1.4e-12 PFAM
Biotin_carb_C 640 747 9.54e-26 SMART
Pfam:Biotin_lipoyl 885 951 9.1e-17 PFAM
Pfam:ACC_central 952 1678 2.3e-250 PFAM
Pfam:Carboxyl_trans 1770 2324 4.8e-172 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000119639
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143276
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,639,111 (GRCm39) Y944C probably damaging Het
Acad8 C T 9: 26,889,698 (GRCm39) R332H probably damaging Het
Acrbp A C 6: 125,027,501 (GRCm39) T50P probably damaging Het
Ahctf1 G T 1: 179,583,077 (GRCm39) N1500K probably benign Het
Aoc1l3 A G 6: 48,964,651 (GRCm39) T220A possibly damaging Het
Arfgef1 A G 1: 10,229,798 (GRCm39) I1301T possibly damaging Het
Arhgef15 T C 11: 68,842,171 (GRCm39) S478G probably benign Het
Armh1 T C 4: 117,094,977 (GRCm39) D21G probably damaging Het
Atp13a4 A T 16: 29,227,779 (GRCm39) L1045* probably null Het
Atp2a3 T A 11: 72,873,506 (GRCm39) L793H probably damaging Het
B4galnt4 C A 7: 140,648,173 (GRCm39) P563Q probably benign Het
Bcl2a1b A T 9: 89,081,713 (GRCm39) K94* probably null Het
Bod1 T A 11: 31,616,853 (GRCm39) Q136L possibly damaging Het
C2cd3 A G 7: 100,055,166 (GRCm39) K443R probably damaging Het
Cadps A G 14: 12,411,588 (GRCm38) V1250A possibly damaging Het
Car12 T A 9: 66,671,600 (GRCm39) Y332* probably null Het
Ccdc186 A T 19: 56,790,432 (GRCm39) probably null Het
Cdh6 T C 15: 13,034,774 (GRCm39) T629A probably damaging Het
Cep112 T A 11: 108,397,471 (GRCm39) D353E probably damaging Het
Cep152 T C 2: 125,428,301 (GRCm39) S777G probably benign Het
Clec4b2 A C 6: 123,181,163 (GRCm39) K183Q probably benign Het
Cngb3 T C 4: 19,395,926 (GRCm39) Y323H probably benign Het
Cnp G T 11: 100,467,202 (GRCm39) E48D probably benign Het
Ctrb1 T A 8: 112,413,783 (GRCm39) I194F probably benign Het
Cyp2d11 T A 15: 82,275,224 (GRCm39) D241V probably benign Het
D5Ertd579e T A 5: 36,772,285 (GRCm39) E703D probably damaging Het
Dlg1 T C 16: 31,676,764 (GRCm39) V731A probably damaging Het
Dlgap5 T C 14: 47,651,276 (GRCm39) S86G probably benign Het
Dock3 C A 9: 106,870,171 (GRCm39) V638F possibly damaging Het
Dock3 A G 9: 106,807,266 (GRCm39) F1354L probably damaging Het
Eif3c A T 7: 126,156,626 (GRCm39) M407K probably benign Het
Eif4a3l1 A T 6: 136,305,737 (GRCm39) Q66L possibly damaging Het
Epha4 T A 1: 77,366,712 (GRCm39) K578* probably null Het
Erc2 C T 14: 27,375,285 (GRCm39) L168F probably damaging Het
Esyt2 A G 12: 116,305,708 (GRCm39) I313V probably benign Het
Far1 T A 7: 113,167,432 (GRCm39) Y506N probably damaging Het
Fbxw26 T A 9: 109,547,037 (GRCm39) N463Y possibly damaging Het
Fgg A G 3: 82,915,847 (GRCm39) D96G probably benign Het
Gfer A G 17: 24,914,274 (GRCm39) S130P probably damaging Het
Hdac10 A T 15: 89,012,650 (GRCm39) M1K probably null Het
Hsd3b1 A T 3: 98,760,642 (GRCm39) S110R probably benign Het
Ints15 A G 5: 143,287,592 (GRCm39) S438P probably benign Het
Itga6 T C 2: 71,668,717 (GRCm39) L552P possibly damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lama2 TTTGCGCATT TTT 10: 26,919,639 (GRCm39) probably null Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Lrrc8a A G 2: 30,147,214 (GRCm39) K676R probably benign Het
Lrrc8b A T 5: 105,628,080 (GRCm39) Y142F probably benign Het
Lyz2 T A 10: 117,114,614 (GRCm39) D105V possibly damaging Het
Mamdc4 T C 2: 25,460,035 (GRCm39) D76G probably damaging Het
Map7d1 T C 4: 126,127,018 (GRCm39) K731E unknown Het
Mgam A C 6: 40,619,988 (GRCm39) I26L probably benign Het
Mmp13 A T 9: 7,272,953 (GRCm39) E104D probably benign Het
Morc2a C T 11: 3,626,664 (GRCm39) R241* probably null Het
Mtfmt C A 9: 65,359,386 (GRCm39) H354N probably benign Het
Myh3 T C 11: 66,990,233 (GRCm39) I1626T probably benign Het
Ndst1 A T 18: 60,825,059 (GRCm39) V753D probably benign Het
Neurl4 A G 11: 69,793,997 (GRCm39) D151G probably damaging Het
Nlrx1 T C 9: 44,168,194 (GRCm39) S568G probably benign Het
Or10g3b G C 14: 52,586,999 (GRCm39) P168R probably damaging Het
Or2t45 T C 11: 58,669,132 (GRCm39) Y60H possibly damaging Het
Or2t46 T G 11: 58,472,546 (GRCm39) L292R probably damaging Het
Or4c52 T C 2: 89,845,762 (GRCm39) F163L probably damaging Het
Or52s1 A G 7: 102,861,747 (GRCm39) I216V probably damaging Het
Or6c66 A T 10: 129,461,468 (GRCm39) I154N probably benign Het
Or8b42 A T 9: 38,342,111 (GRCm39) M178L probably benign Het
Osbpl7 A G 11: 96,950,976 (GRCm39) I608V probably damaging Het
Pard3b T C 1: 61,807,159 (GRCm39) I58T probably damaging Het
Pcare A G 17: 72,058,066 (GRCm39) M537T probably damaging Het
Pcdhga1 A C 18: 37,795,407 (GRCm39) E137A possibly damaging Het
Pde6c G A 19: 38,139,072 (GRCm39) V301I possibly damaging Het
Pdia5 G C 16: 35,230,786 (GRCm39) N338K possibly damaging Het
Pex11g T C 8: 3,514,042 (GRCm39) Y40C probably damaging Het
Plekhg3 A G 12: 76,610,899 (GRCm39) Y183C probably damaging Het
Pole A C 5: 110,438,090 (GRCm39) probably null Het
Ppfia1 A G 7: 144,045,313 (GRCm39) L948P probably damaging Het
Prdm2 A T 4: 142,860,761 (GRCm39) V843E probably damaging Het
Prss56 C A 1: 87,115,708 (GRCm39) F527L probably damaging Het
Psmd11 T C 11: 80,329,146 (GRCm39) L88P probably damaging Het
Ptx3 G C 3: 66,132,412 (GRCm39) G311A probably damaging Het
Rars1 A T 11: 35,699,385 (GRCm39) L636H probably damaging Het
Rnft2 A G 5: 118,375,507 (GRCm39) S81P probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Rxra T A 2: 27,631,195 (GRCm39) I142N probably damaging Het
Scin T C 12: 40,154,931 (GRCm39) M221V probably benign Het
Sfmbt2 G A 2: 10,584,069 (GRCm39) V809I possibly damaging Het
Sirt1 T A 10: 63,157,783 (GRCm39) I505F probably benign Het
Six5 T C 7: 18,829,096 (GRCm39) Y179H probably damaging Het
Slc12a4 A C 8: 106,671,241 (GRCm39) M982R probably damaging Het
Slco4c1 T A 1: 96,765,237 (GRCm39) L404F probably damaging Het
Smn1 T C 13: 100,268,931 (GRCm39) L259P probably damaging Het
Sorl1 T G 9: 41,952,935 (GRCm39) D702A probably damaging Het
Spta1 A G 1: 174,065,400 (GRCm39) E1983G possibly damaging Het
Srsf1 T A 11: 87,940,788 (GRCm39) probably null Het
Stard9 C T 2: 120,536,900 (GRCm39) R4224* probably null Het
Sybu T G 15: 44,538,895 (GRCm39) M383L probably benign Het
Tbx15 A C 3: 99,259,583 (GRCm39) N485H possibly damaging Het
Tcerg1l A T 7: 137,819,786 (GRCm39) F485I probably damaging Het
Tdrd7 C A 4: 46,005,616 (GRCm39) T474N possibly damaging Het
Thada A T 17: 84,755,470 (GRCm39) probably null Het
Tnik A T 3: 28,704,235 (GRCm39) I1020F probably damaging Het
Tnxb A G 17: 34,914,566 (GRCm39) D1884G possibly damaging Het
Tprn T C 2: 25,158,845 (GRCm39) M623T probably damaging Het
Trdn T A 10: 33,350,413 (GRCm39) Y661N probably damaging Het
Ttc41 T C 10: 86,612,056 (GRCm39) S1110P possibly damaging Het
Ttc6 A C 12: 57,707,026 (GRCm39) R644S probably benign Het
Ttyh1 A T 7: 4,136,735 (GRCm39) M448L probably benign Het
Unc79 G T 12: 103,128,079 (GRCm39) C2250F probably damaging Het
Ush2a A G 1: 188,358,805 (GRCm39) I2110M probably benign Het
Uvssa G T 5: 33,571,257 (GRCm39) E634* probably null Het
Vac14 A C 8: 111,372,440 (GRCm39) T384P probably benign Het
Wdr11 A G 7: 129,235,445 (GRCm39) E1169G probably benign Het
Zfp36l1 T A 12: 80,157,298 (GRCm39) T28S probably benign Het
Zfp715 A T 7: 42,949,106 (GRCm39) Y285N possibly damaging Het
Zfp91 A T 19: 12,747,424 (GRCm39) D566E probably damaging Het
Zgrf1 G A 3: 127,396,085 (GRCm39) V544M probably damaging Het
Other mutations in Acacb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Acacb APN 5 114,338,350 (GRCm39) missense probably damaging 1.00
IGL01291:Acacb APN 5 114,363,931 (GRCm39) missense probably benign 0.03
IGL01301:Acacb APN 5 114,384,559 (GRCm39) missense probably benign
IGL01633:Acacb APN 5 114,356,919 (GRCm39) splice site probably benign
IGL01736:Acacb APN 5 114,326,503 (GRCm39) missense possibly damaging 0.96
IGL01782:Acacb APN 5 114,338,581 (GRCm39) missense probably damaging 1.00
IGL01924:Acacb APN 5 114,362,047 (GRCm39) splice site probably benign
IGL01933:Acacb APN 5 114,322,251 (GRCm39) splice site probably benign
IGL02028:Acacb APN 5 114,304,076 (GRCm39) missense probably damaging 1.00
IGL02045:Acacb APN 5 114,378,721 (GRCm39) missense possibly damaging 0.95
IGL02346:Acacb APN 5 114,376,760 (GRCm39) missense probably damaging 1.00
IGL02421:Acacb APN 5 114,361,939 (GRCm39) missense probably benign 0.00
IGL02445:Acacb APN 5 114,383,198 (GRCm39) missense probably damaging 1.00
IGL02491:Acacb APN 5 114,330,166 (GRCm39) missense probably damaging 1.00
IGL02598:Acacb APN 5 114,384,098 (GRCm39) missense probably damaging 1.00
IGL02700:Acacb APN 5 114,356,942 (GRCm39) missense probably damaging 1.00
IGL02730:Acacb APN 5 114,304,210 (GRCm39) splice site probably benign
IGL03110:Acacb APN 5 114,333,295 (GRCm39) missense probably damaging 0.96
IGL03125:Acacb APN 5 114,342,866 (GRCm39) missense possibly damaging 0.49
IGL03263:Acacb APN 5 114,351,754 (GRCm39) missense probably damaging 1.00
IGL03324:Acacb APN 5 114,363,915 (GRCm39) nonsense probably null
acetone UTSW 5 114,364,918 (GRCm39) nonsense probably null
anabolism UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
ANU05:Acacb UTSW 5 114,363,931 (GRCm39) missense probably benign 0.03
ANU18:Acacb UTSW 5 114,384,559 (GRCm39) missense probably benign
BB001:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
BB011:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
I0000:Acacb UTSW 5 114,376,716 (GRCm39) missense probably damaging 0.99
R0001:Acacb UTSW 5 114,342,894 (GRCm39) splice site probably benign
R0219:Acacb UTSW 5 114,371,005 (GRCm39) missense possibly damaging 0.79
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0234:Acacb UTSW 5 114,347,878 (GRCm39) missense probably damaging 0.99
R0278:Acacb UTSW 5 114,371,320 (GRCm39) nonsense probably null
R0607:Acacb UTSW 5 114,338,362 (GRCm39) missense probably damaging 1.00
R0964:Acacb UTSW 5 114,367,813 (GRCm39) missense possibly damaging 0.64
R1116:Acacb UTSW 5 114,349,017 (GRCm39) missense probably damaging 1.00
R1196:Acacb UTSW 5 114,383,153 (GRCm39) missense probably benign 0.00
R1204:Acacb UTSW 5 114,328,214 (GRCm39) missense probably damaging 1.00
R1387:Acacb UTSW 5 114,338,573 (GRCm39) missense probably benign
R1415:Acacb UTSW 5 114,303,982 (GRCm39) missense probably benign
R1475:Acacb UTSW 5 114,333,313 (GRCm39) missense possibly damaging 0.87
R1497:Acacb UTSW 5 114,334,868 (GRCm39) missense probably damaging 1.00
R1520:Acacb UTSW 5 114,340,001 (GRCm39) missense possibly damaging 0.67
R1591:Acacb UTSW 5 114,341,484 (GRCm39) missense possibly damaging 0.87
R1644:Acacb UTSW 5 114,333,346 (GRCm39) missense probably damaging 1.00
R1732:Acacb UTSW 5 114,328,148 (GRCm39) missense possibly damaging 0.63
R1783:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1784:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R1834:Acacb UTSW 5 114,373,536 (GRCm39) missense probably damaging 1.00
R1858:Acacb UTSW 5 114,334,770 (GRCm39) missense probably benign 0.13
R1886:Acacb UTSW 5 114,357,020 (GRCm39) missense probably damaging 1.00
R1901:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1902:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1903:Acacb UTSW 5 114,303,795 (GRCm39) nonsense probably null
R1924:Acacb UTSW 5 114,368,781 (GRCm39) missense possibly damaging 0.67
R1934:Acacb UTSW 5 114,336,343 (GRCm39) missense probably benign 0.27
R2051:Acacb UTSW 5 114,383,951 (GRCm39) missense probably damaging 1.00
R2132:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2133:Acacb UTSW 5 114,347,828 (GRCm39) frame shift probably null
R2260:Acacb UTSW 5 114,354,978 (GRCm39) missense probably damaging 0.99
R2967:Acacb UTSW 5 114,304,131 (GRCm39) missense possibly damaging 0.81
R3421:Acacb UTSW 5 114,350,697 (GRCm39) splice site probably null
R3729:Acacb UTSW 5 114,345,409 (GRCm39) missense probably damaging 0.99
R4206:Acacb UTSW 5 114,351,712 (GRCm39) missense probably benign
R4245:Acacb UTSW 5 114,368,845 (GRCm39) missense probably damaging 0.97
R4386:Acacb UTSW 5 114,379,982 (GRCm39) critical splice acceptor site probably null
R4439:Acacb UTSW 5 114,384,557 (GRCm39) missense possibly damaging 0.50
R4577:Acacb UTSW 5 114,364,892 (GRCm39) missense probably damaging 1.00
R4658:Acacb UTSW 5 114,338,625 (GRCm39) missense probably damaging 0.96
R4688:Acacb UTSW 5 114,342,824 (GRCm39) missense probably benign 0.01
R4720:Acacb UTSW 5 114,367,975 (GRCm39) missense possibly damaging 0.73
R5044:Acacb UTSW 5 114,304,088 (GRCm39) missense probably benign 0.03
R5070:Acacb UTSW 5 114,384,089 (GRCm39) missense possibly damaging 0.46
R5294:Acacb UTSW 5 114,380,013 (GRCm39) missense probably damaging 1.00
R5350:Acacb UTSW 5 114,382,612 (GRCm39) missense probably damaging 1.00
R5401:Acacb UTSW 5 114,347,914 (GRCm39) missense possibly damaging 0.80
R5531:Acacb UTSW 5 114,342,767 (GRCm39) missense possibly damaging 0.92
R5542:Acacb UTSW 5 114,333,798 (GRCm39) missense probably damaging 1.00
R5751:Acacb UTSW 5 114,368,893 (GRCm39) missense possibly damaging 0.79
R5821:Acacb UTSW 5 114,322,167 (GRCm39) missense possibly damaging 0.69
R5893:Acacb UTSW 5 114,367,912 (GRCm39) missense probably benign 0.01
R5911:Acacb UTSW 5 114,370,951 (GRCm39) missense probably damaging 0.97
R5944:Acacb UTSW 5 114,384,041 (GRCm39) missense probably damaging 1.00
R5973:Acacb UTSW 5 114,364,928 (GRCm39) missense probably damaging 1.00
R6027:Acacb UTSW 5 114,303,661 (GRCm39) missense probably benign 0.43
R6103:Acacb UTSW 5 114,383,942 (GRCm39) missense probably damaging 1.00
R6139:Acacb UTSW 5 114,350,713 (GRCm39) missense probably damaging 1.00
R6292:Acacb UTSW 5 114,338,312 (GRCm39) missense probably damaging 1.00
R6368:Acacb UTSW 5 114,354,884 (GRCm39) missense probably damaging 0.98
R6429:Acacb UTSW 5 114,366,652 (GRCm39) missense probably damaging 1.00
R6942:Acacb UTSW 5 114,330,024 (GRCm39) critical splice donor site probably null
R7138:Acacb UTSW 5 114,345,387 (GRCm39) missense probably benign 0.12
R7241:Acacb UTSW 5 114,383,161 (GRCm39) missense possibly damaging 0.94
R7254:Acacb UTSW 5 114,347,812 (GRCm39) critical splice acceptor site probably null
R7396:Acacb UTSW 5 114,351,722 (GRCm39) missense possibly damaging 0.87
R7439:Acacb UTSW 5 114,333,703 (GRCm39) missense possibly damaging 0.84
R7484:Acacb UTSW 5 114,356,923 (GRCm39) missense probably damaging 1.00
R7585:Acacb UTSW 5 114,384,073 (GRCm39) missense probably damaging 0.99
R7712:Acacb UTSW 5 114,303,799 (GRCm39) missense probably benign 0.13
R7868:Acacb UTSW 5 114,386,288 (GRCm39) missense probably benign 0.22
R7873:Acacb UTSW 5 114,361,339 (GRCm39) missense possibly damaging 0.88
R7924:Acacb UTSW 5 114,383,281 (GRCm39) missense possibly damaging 0.63
R7940:Acacb UTSW 5 114,304,108 (GRCm39) missense possibly damaging 0.77
R7951:Acacb UTSW 5 114,326,401 (GRCm39) missense probably damaging 1.00
R7960:Acacb UTSW 5 114,368,922 (GRCm39) missense probably benign 0.00
R7972:Acacb UTSW 5 114,364,918 (GRCm39) nonsense probably null
R8007:Acacb UTSW 5 114,356,935 (GRCm39) missense probably damaging 0.97
R8022:Acacb UTSW 5 114,361,915 (GRCm39) missense probably benign
R8030:Acacb UTSW 5 114,371,228 (GRCm39) missense probably damaging 1.00
R8241:Acacb UTSW 5 114,333,297 (GRCm39) missense possibly damaging 0.49
R8264:Acacb UTSW 5 114,345,427 (GRCm39) missense probably benign 0.00
R8292:Acacb UTSW 5 114,338,555 (GRCm39) critical splice acceptor site probably null
R8678:Acacb UTSW 5 114,340,032 (GRCm39) nonsense probably null
R8693:Acacb UTSW 5 114,364,844 (GRCm39) missense probably damaging 0.99
R8697:Acacb UTSW 5 114,351,441 (GRCm39) missense probably damaging 0.96
R8772:Acacb UTSW 5 114,322,179 (GRCm39) missense possibly damaging 0.73
R8918:Acacb UTSW 5 114,333,315 (GRCm39) missense probably damaging 1.00
R9008:Acacb UTSW 5 114,386,815 (GRCm39) splice site silent
R9044:Acacb UTSW 5 114,373,578 (GRCm39) missense probably benign 0.00
R9165:Acacb UTSW 5 114,354,744 (GRCm39) missense probably benign 0.01
R9231:Acacb UTSW 5 114,349,153 (GRCm39) missense probably benign 0.01
R9440:Acacb UTSW 5 114,384,085 (GRCm39) missense possibly damaging 0.56
R9444:Acacb UTSW 5 114,384,020 (GRCm39) missense probably damaging 0.99
R9562:Acacb UTSW 5 114,371,397 (GRCm39) missense probably damaging 0.99
R9794:Acacb UTSW 5 114,387,578 (GRCm39) missense probably benign 0.00
V1662:Acacb UTSW 5 114,376,769 (GRCm39) missense probably damaging 1.00
Z1176:Acacb UTSW 5 114,387,009 (GRCm39) missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGGCACTCTGACATGTCACC -3'
(R):5'- AGGTGATGTCATTGCCGATG -3'

Sequencing Primer
(F):5'- TGACATGTCACCTCCAACCAGG -3'
(R):5'- GATACTCCGGGGTCTTGAAC -3'
Posted On 2016-03-17