Mutagenetix > Incidental Mutation

Incidental Mutation 'R4898:Acacb'

375889

Institutional Source

Beutler Lab

Gene Symbol

Acacb

Ensembl Gene

ENSMUSG00000042010

Gene Name

acetyl-Coenzyme A carboxylase beta

Synonyms

Acc2, Accb

MMRRC Submission

042502-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4898 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

114146535-114250761 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 114232938 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 1747 (V1747A)

Ref Sequence

ENSEMBL: ENSMUSP00000099642 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031583] [ENSMUST00000102582]

AlphaFold

E9Q4Z2

Predicted Effect

probably benign
Transcript: ENSMUST00000031583
AA Change: V1747A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000031583
Gene: ENSMUSG00000042010
AA Change: V1747A

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	2.1e-32	PFAM
Pfam:CPSase_L_D2	405	606	3.3e-52	PFAM
Pfam:ATP-grasp_4	413	576	2.1e-9	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	1.9e-17	PFAM
Pfam:ACC_central	952	1678	2.2e-290	PFAM
Pfam:Carboxyl_trans	1770	2324	2.3e-181	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000102582
AA Change: V1747A

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000099642
Gene: ENSMUSG00000042010
AA Change: V1747A

Domain	Start	End	E-Value	Type
signal peptide	1	16	N/A	INTRINSIC
low complexity region	38	60	N/A	INTRINSIC
Pfam:CPSase_L_chain	249	369	8.2e-29	PFAM
Pfam:CPSase_L_D2	405	606	3.8e-52	PFAM
Pfam:ATP-grasp_4	409	576	1.4e-12	PFAM
Biotin_carb_C	640	747	9.54e-26	SMART
Pfam:Biotin_lipoyl	885	951	9.1e-17	PFAM
Pfam:ACC_central	952	1678	2.3e-250	PFAM
Pfam:Carboxyl_trans	1770	2324	4.8e-172	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000119639

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143276

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Acetyl-CoA carboxylase (ACC) is a complex multifunctional enzyme system. ACC is a biotin-containing enzyme which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ACC-beta is thought to control fatty acid oxidation by means of the ability of malonyl-CoA to inhibit carnitine-palmitoyl-CoA transferase I, the rate-limiting step in fatty acid uptake and oxidation by mitochondria. ACC-beta may be involved in the regulation of fatty acid oxidation, rather than fatty acid biosynthesis. There is evidence for the presence of two ACC-beta isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable, fertile and overtly normal but exhibit high levels of fatty acid oxidation, as well as reduced fat accumulation in their adipose tissue and liver, and decreased storage of glycogen in their liver. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 45,989,687	Y944C	probably damaging	Het
Acad8	C	T	9: 26,978,402	R332H	probably damaging	Het
Acrbp	A	C	6: 125,050,538	T50P	probably damaging	Het
Ahctf1	G	T	1: 179,755,512	N1500K	probably benign	Het
Arfgef1	A	G	1: 10,159,573	I1301T	possibly damaging	Het
Arhgef15	T	C	11: 68,951,345	S478G	probably benign	Het
Armh1	T	C	4: 117,237,780	D21G	probably damaging	Het
Atp13a4	A	T	16: 29,408,961	L1045*	probably null	Het
Atp2a3	T	A	11: 72,982,680	L793H	probably damaging	Het
B4galnt4	C	A	7: 141,068,260	P563Q	probably benign	Het
BC027072	A	G	17: 71,751,071	M537T	probably damaging	Het
Bcl2a1b	A	T	9: 89,199,660	K94*	probably null	Het
Bod1	T	A	11: 31,666,853	Q136L	possibly damaging	Het
C2cd3	A	G	7: 100,405,959	K443R	probably damaging	Het
Cadps	A	G	14: 12,411,588	V1250A	possibly damaging	Het
Car12	T	A	9: 66,764,318	Y332*	probably null	Het
Ccdc186	A	T	19: 56,802,000		probably null	Het
Cdh6	T	C	15: 13,034,688	T629A	probably damaging	Het
Cep112	T	A	11: 108,506,645	D353E	probably damaging	Het
Cep152	T	C	2: 125,586,381	S777G	probably benign	Het
Clec4b2	A	C	6: 123,204,204	K183Q	probably benign	Het
Cngb3	T	C	4: 19,395,926	Y323H	probably benign	Het
Cnp	G	T	11: 100,576,376	E48D	probably benign	Het
Ctrb1	T	A	8: 111,687,151	I194F	probably benign	Het
Cyp2d11	T	A	15: 82,391,023	D241V	probably benign	Het
D5Ertd579e	T	A	5: 36,614,941	E703D	probably damaging	Het
Dlg1	T	C	16: 31,857,946	V731A	probably damaging	Het
Dlgap5	T	C	14: 47,413,819	S86G	probably benign	Het
Dock3	A	G	9: 106,930,067	F1354L	probably damaging	Het
Dock3	C	A	9: 106,992,972	V638F	possibly damaging	Het
E130309D02Rik	A	G	5: 143,301,837	S438P	probably benign	Het
Eif3c	A	T	7: 126,557,454	M407K	probably benign	Het
Epha4	T	A	1: 77,390,075	K578*	probably null	Het
Erc2	C	T	14: 27,653,328	L168F	probably damaging	Het
Esyt2	A	G	12: 116,342,088	I313V	probably benign	Het
Far1	T	A	7: 113,568,225	Y506N	probably damaging	Het
Fbxw26	T	A	9: 109,717,969	N463Y	possibly damaging	Het
Fgg	A	G	3: 83,008,540	D96G	probably benign	Het
Gfer	A	G	17: 24,695,300	S130P	probably damaging	Het
Gm8994	A	T	6: 136,328,739	Q66L	possibly damaging	Het
Hdac10	A	T	15: 89,128,447	M1K	probably null	Het
Hsd3b1	A	T	3: 98,853,326	S110R	probably benign	Het
Itga6	T	C	2: 71,838,373	L552P	possibly damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lama2	TTTGCGCATT	TTT	10: 27,043,643		probably null	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Lrrc8a	A	G	2: 30,257,202	K676R	probably benign	Het
Lrrc8b	A	T	5: 105,480,214	Y142F	probably benign	Het
Lyz2	T	A	10: 117,278,709	D105V	possibly damaging	Het
Mamdc4	T	C	2: 25,570,023	D76G	probably damaging	Het
Map7d1	T	C	4: 126,233,225	K731E	unknown	Het
Mgam	A	C	6: 40,643,054	I26L	probably benign	Het
Mmp13	A	T	9: 7,272,953	E104D	probably benign	Het
Morc2a	C	T	11: 3,676,664	R241*	probably null	Het
Mtfmt	C	A	9: 65,452,104	H354N	probably benign	Het
Myh3	T	C	11: 67,099,407	I1626T	probably benign	Het
Ndst1	A	T	18: 60,691,987	V753D	probably benign	Het
Neurl4	A	G	11: 69,903,171	D151G	probably damaging	Het
Nlrx1	T	C	9: 44,256,897	S568G	probably benign	Het
Olfr1263	T	C	2: 90,015,418	F163L	probably damaging	Het
Olfr1513	G	C	14: 52,349,542	P168R	probably damaging	Het
Olfr315	T	C	11: 58,778,306	Y60H	possibly damaging	Het
Olfr325	T	G	11: 58,581,720	L292R	probably damaging	Het
Olfr593	A	G	7: 103,212,540	I216V	probably damaging	Het
Olfr798	A	T	10: 129,625,599	I154N	probably benign	Het
Olfr901	A	T	9: 38,430,815	M178L	probably benign	Het
Osbpl7	A	G	11: 97,060,150	I608V	probably damaging	Het
Pard3b	T	C	1: 61,768,000	I58T	probably damaging	Het
Pcdhga1	A	C	18: 37,662,354	E137A	possibly damaging	Het
Pde6c	G	A	19: 38,150,624	V301I	possibly damaging	Het
Pdia5	G	C	16: 35,410,416	N338K	possibly damaging	Het
Pex11g	T	C	8: 3,464,042	Y40C	probably damaging	Het
Plekhg3	A	G	12: 76,564,125	Y183C	probably damaging	Het
Pole	A	C	5: 110,290,224		probably null	Het
Ppfia1	A	G	7: 144,491,576	L948P	probably damaging	Het
Prdm2	A	T	4: 143,134,191	V843E	probably damaging	Het
Prss56	C	A	1: 87,187,986	F527L	probably damaging	Het
Psmd11	T	C	11: 80,438,320	L88P	probably damaging	Het
Ptx3	G	C	3: 66,224,991	G311A	probably damaging	Het
Rars	A	T	11: 35,808,558	L636H	probably damaging	Het
Rnft2	A	G	5: 118,237,442	S81P	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxra	T	A	2: 27,741,183	I142N	probably damaging	Het
Scin	T	C	12: 40,104,932	M221V	probably benign	Het
Sfmbt2	G	A	2: 10,579,258	V809I	possibly damaging	Het
Sirt1	T	A	10: 63,322,004	I505F	probably benign	Het
Six5	T	C	7: 19,095,171	Y179H	probably damaging	Het
Slc12a4	A	C	8: 105,944,609	M982R	probably damaging	Het
Slco4c1	T	A	1: 96,837,512	L404F	probably damaging	Het
Smn1	T	C	13: 100,132,423	L259P	probably damaging	Het
Sorl1	T	G	9: 42,041,639	D702A	probably damaging	Het
Spta1	A	G	1: 174,237,834	E1983G	possibly damaging	Het
Srsf1	T	A	11: 88,049,962		probably null	Het
Stard9	C	T	2: 120,706,419	R4224*	probably null	Het
Svs1	A	G	6: 48,987,717	T220A	possibly damaging	Het
Sybu	T	G	15: 44,675,499	M383L	probably benign	Het
Tbx15	A	C	3: 99,352,267	N485H	possibly damaging	Het
Tcerg1l	A	T	7: 138,218,057	F485I	probably damaging	Het
Tdrd7	C	A	4: 46,005,616	T474N	possibly damaging	Het
Thada	A	T	17: 84,448,042		probably null	Het
Tnik	A	T	3: 28,650,086	I1020F	probably damaging	Het
Tnxb	A	G	17: 34,695,592	D1884G	possibly damaging	Het
Tprn	T	C	2: 25,268,833	M623T	probably damaging	Het
Trdn	T	A	10: 33,474,417	Y661N	probably damaging	Het
Ttc41	T	C	10: 86,776,192	S1110P	possibly damaging	Het
Ttc6	A	C	12: 57,660,240	R644S	probably benign	Het
Ttyh1	A	T	7: 4,133,736	M448L	probably benign	Het
Unc79	G	T	12: 103,161,820	C2250F	probably damaging	Het
Ush2a	A	G	1: 188,626,608	I2110M	probably benign	Het
Uvssa	G	T	5: 33,413,913	E634*	probably null	Het
Vac14	A	C	8: 110,645,808	T384P	probably benign	Het
Wdr11	A	G	7: 129,633,721	E1169G	probably benign	Het
Zfp36l1	T	A	12: 80,110,524	T28S	probably benign	Het
Zfp715	A	T	7: 43,299,682	Y285N	possibly damaging	Het
Zfp91	A	T	19: 12,770,060	D566E	probably damaging	Het
Zgrf1	G	A	3: 127,602,436	V544M	probably damaging	Het

Other mutations in Acacb

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00482:Acacb	APN	5	114200289	missense	probably damaging	1.00
IGL01291:Acacb	APN	5	114225870	missense	probably benign	0.03
IGL01301:Acacb	APN	5	114246498	missense	probably benign
IGL01633:Acacb	APN	5	114218858	splice site	probably benign
IGL01736:Acacb	APN	5	114188442	missense	possibly damaging	0.96
IGL01782:Acacb	APN	5	114200520	missense	probably damaging	1.00
IGL01924:Acacb	APN	5	114223986	splice site	probably benign
IGL01933:Acacb	APN	5	114184190	splice site	probably benign
IGL02028:Acacb	APN	5	114166015	missense	probably damaging	1.00
IGL02045:Acacb	APN	5	114240660	missense	possibly damaging	0.95
IGL02346:Acacb	APN	5	114238699	missense	probably damaging	1.00
IGL02421:Acacb	APN	5	114223878	missense	probably benign	0.00
IGL02445:Acacb	APN	5	114245137	missense	probably damaging	1.00
IGL02491:Acacb	APN	5	114192105	missense	probably damaging	1.00
IGL02598:Acacb	APN	5	114246037	missense	probably damaging	1.00
IGL02700:Acacb	APN	5	114218881	missense	probably damaging	1.00
IGL02730:Acacb	APN	5	114166149	splice site	probably benign
IGL03110:Acacb	APN	5	114195234	missense	probably damaging	0.96
IGL03125:Acacb	APN	5	114204805	missense	possibly damaging	0.49
IGL03263:Acacb	APN	5	114213693	missense	probably damaging	1.00
IGL03324:Acacb	APN	5	114225854	nonsense	probably null
acetone	UTSW	5	114226857	nonsense	probably null
anabolism	UTSW	5	114245220	missense	possibly damaging	0.63
ANU05:Acacb	UTSW	5	114225870	missense	probably benign	0.03
ANU18:Acacb	UTSW	5	114246498	missense	probably benign
BB001:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
BB011:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
I0000:Acacb	UTSW	5	114238655	missense	probably damaging	0.99
R0001:Acacb	UTSW	5	114204833	splice site	probably benign
R0219:Acacb	UTSW	5	114232944	missense	possibly damaging	0.79
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0234:Acacb	UTSW	5	114209817	missense	probably damaging	0.99
R0278:Acacb	UTSW	5	114233259	nonsense	probably null
R0607:Acacb	UTSW	5	114200301	missense	probably damaging	1.00
R0964:Acacb	UTSW	5	114229752	missense	possibly damaging	0.64
R1116:Acacb	UTSW	5	114210956	missense	probably damaging	1.00
R1196:Acacb	UTSW	5	114245092	missense	probably benign	0.00
R1204:Acacb	UTSW	5	114190153	missense	probably damaging	1.00
R1387:Acacb	UTSW	5	114200512	missense	probably benign
R1415:Acacb	UTSW	5	114165921	missense	probably benign
R1475:Acacb	UTSW	5	114195252	missense	possibly damaging	0.87
R1497:Acacb	UTSW	5	114196807	missense	probably damaging	1.00
R1520:Acacb	UTSW	5	114201940	missense	possibly damaging	0.67
R1591:Acacb	UTSW	5	114203423	missense	possibly damaging	0.87
R1644:Acacb	UTSW	5	114195285	missense	probably damaging	1.00
R1732:Acacb	UTSW	5	114190087	missense	possibly damaging	0.63
R1783:Acacb	UTSW	5	114209767	frame shift	probably null
R1784:Acacb	UTSW	5	114209767	frame shift	probably null
R1834:Acacb	UTSW	5	114235475	missense	probably damaging	1.00
R1858:Acacb	UTSW	5	114196709	missense	probably benign	0.13
R1886:Acacb	UTSW	5	114218959	missense	probably damaging	1.00
R1901:Acacb	UTSW	5	114165734	nonsense	probably null
R1902:Acacb	UTSW	5	114165734	nonsense	probably null
R1903:Acacb	UTSW	5	114165734	nonsense	probably null
R1924:Acacb	UTSW	5	114230720	missense	possibly damaging	0.67
R1934:Acacb	UTSW	5	114198282	missense	probably benign	0.27
R2051:Acacb	UTSW	5	114245890	missense	probably damaging	1.00
R2132:Acacb	UTSW	5	114209767	frame shift	probably null
R2133:Acacb	UTSW	5	114209767	frame shift	probably null
R2260:Acacb	UTSW	5	114216917	missense	probably damaging	0.99
R2967:Acacb	UTSW	5	114166070	missense	possibly damaging	0.81
R3421:Acacb	UTSW	5	114212636	splice site	probably null
R3729:Acacb	UTSW	5	114207348	missense	probably damaging	0.99
R4206:Acacb	UTSW	5	114213651	missense	probably benign
R4245:Acacb	UTSW	5	114230784	missense	probably damaging	0.97
R4386:Acacb	UTSW	5	114241921	critical splice acceptor site	probably null
R4439:Acacb	UTSW	5	114246496	missense	possibly damaging	0.50
R4577:Acacb	UTSW	5	114226831	missense	probably damaging	1.00
R4658:Acacb	UTSW	5	114200564	missense	probably damaging	0.96
R4688:Acacb	UTSW	5	114204763	missense	probably benign	0.01
R4720:Acacb	UTSW	5	114229914	missense	possibly damaging	0.73
R5044:Acacb	UTSW	5	114166027	missense	probably benign	0.03
R5070:Acacb	UTSW	5	114246028	missense	possibly damaging	0.46
R5294:Acacb	UTSW	5	114241952	missense	probably damaging	1.00
R5350:Acacb	UTSW	5	114244551	missense	probably damaging	1.00
R5401:Acacb	UTSW	5	114209853	missense	possibly damaging	0.80
R5531:Acacb	UTSW	5	114204706	missense	possibly damaging	0.92
R5542:Acacb	UTSW	5	114195737	missense	probably damaging	1.00
R5751:Acacb	UTSW	5	114230832	missense	possibly damaging	0.79
R5821:Acacb	UTSW	5	114184106	missense	possibly damaging	0.69
R5893:Acacb	UTSW	5	114229851	missense	probably benign	0.01
R5911:Acacb	UTSW	5	114232890	missense	probably damaging	0.97
R5944:Acacb	UTSW	5	114245980	missense	probably damaging	1.00
R5973:Acacb	UTSW	5	114226867	missense	probably damaging	1.00
R6027:Acacb	UTSW	5	114165600	missense	probably benign	0.43
R6103:Acacb	UTSW	5	114245881	missense	probably damaging	1.00
R6139:Acacb	UTSW	5	114212652	missense	probably damaging	1.00
R6292:Acacb	UTSW	5	114200251	missense	probably damaging	1.00
R6368:Acacb	UTSW	5	114216823	missense	probably damaging	0.98
R6429:Acacb	UTSW	5	114228591	missense	probably damaging	1.00
R6942:Acacb	UTSW	5	114191963	critical splice donor site	probably null
R7138:Acacb	UTSW	5	114207326	missense	probably benign	0.12
R7241:Acacb	UTSW	5	114245100	missense	possibly damaging	0.94
R7254:Acacb	UTSW	5	114209751	critical splice acceptor site	probably null
R7396:Acacb	UTSW	5	114213661	missense	possibly damaging	0.87
R7439:Acacb	UTSW	5	114195642	missense	possibly damaging	0.84
R7484:Acacb	UTSW	5	114218862	missense	probably damaging	1.00
R7585:Acacb	UTSW	5	114246012	missense	probably damaging	0.99
R7712:Acacb	UTSW	5	114165738	missense	probably benign	0.13
R7868:Acacb	UTSW	5	114248227	missense	probably benign	0.22
R7873:Acacb	UTSW	5	114223278	missense	possibly damaging	0.88
R7924:Acacb	UTSW	5	114245220	missense	possibly damaging	0.63
R7940:Acacb	UTSW	5	114166047	missense	possibly damaging	0.77
R7951:Acacb	UTSW	5	114188340	missense	probably damaging	1.00
R7960:Acacb	UTSW	5	114230861	missense	probably benign	0.00
R7972:Acacb	UTSW	5	114226857	nonsense	probably null
R8007:Acacb	UTSW	5	114218874	missense	probably damaging	0.97
R8022:Acacb	UTSW	5	114223854	missense	probably benign
R8030:Acacb	UTSW	5	114233167	missense	probably damaging	1.00
R8241:Acacb	UTSW	5	114195236	missense	possibly damaging	0.49
R8264:Acacb	UTSW	5	114207366	missense	probably benign	0.00
R8292:Acacb	UTSW	5	114200494	critical splice acceptor site	probably null
R8678:Acacb	UTSW	5	114201971	nonsense	probably null
R8693:Acacb	UTSW	5	114226783	missense	probably damaging	0.99
R8697:Acacb	UTSW	5	114213380	missense	probably damaging	0.96
R8772:Acacb	UTSW	5	114184118	missense	possibly damaging	0.73
R8918:Acacb	UTSW	5	114195254	missense	probably damaging	1.00
R9008:Acacb	UTSW	5	114248754	splice site	silent
R9044:Acacb	UTSW	5	114235517	missense	probably benign	0.00
R9165:Acacb	UTSW	5	114216683	missense	probably benign	0.01
R9231:Acacb	UTSW	5	114211092	missense	probably benign	0.01
R9440:Acacb	UTSW	5	114246024	missense	possibly damaging	0.56
R9444:Acacb	UTSW	5	114245959	missense	probably damaging	0.99
R9562:Acacb	UTSW	5	114233336	missense	probably damaging	0.99
R9794:Acacb	UTSW	5	114249517	missense	probably benign	0.00
V1662:Acacb	UTSW	5	114238708	missense	probably damaging	1.00
Z1176:Acacb	UTSW	5	114248948	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- TGGCACTCTGACATGTCACC -3'
(R):5'- AGGTGATGTCATTGCCGATG -3'

Sequencing Primer
(F):5'- TGACATGTCACCTCCAACCAGG -3'
(R):5'- GATACTCCGGGGTCTTGAAC -3'

Posted On

2016-03-17