Incidental Mutation 'R4898:Mmp13'
ID375915
Institutional Source Beutler Lab
Gene Symbol Mmp13
Ensembl Gene ENSMUSG00000050578
Gene Namematrix metallopeptidase 13
SynonymsMMP-13, interstitial collagenase, Clg, Mmp1, Collagenase-3, collagenase-1
MMRRC Submission 042502-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R4898 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location7272514-7283331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 7272953 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 104 (E104D)
Ref Sequence ENSEMBL: ENSMUSP00000015394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015394]
PDB Structure
STRUCTURE OF RECOMBINANT MOUSE COLLAGENASE-3 (MMP-13) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015394
AA Change: E104D

PolyPhen 2 Score 0.097 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000015394
Gene: ENSMUSG00000050578
AA Change: E104D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 33 92 5.3e-13 PFAM
ZnMc 110 269 3.76e-59 SMART
HX 291 333 9.62e-8 SMART
HX 335 378 9.91e-10 SMART
HX 383 430 2.52e-11 SMART
HX 432 472 1.81e-3 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family that plays a role in wound healing, skeletal development and bone remodeling. The encoded protein is activated by the removal of an N-terminal activation peptide to generate a zinc-dependent endopeptidase enzyme that can cleave various native collagens, including types I - IV, X and XIV. Mice lacking the encoded protein display profound defects in growth plate cartilage as well as a delay in the endochondral bone development. Lack of the encoded protein also impairs the wound healing process due to reduced keratinocyte migration and vascular density at the wound site. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Jun 2015]
PHENOTYPE: Homozygous null mice display increased width of hypertrophic chondrocyte zone and increased trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,989,687 Y944C probably damaging Het
Acacb T C 5: 114,232,938 V1747A probably benign Het
Acad8 C T 9: 26,978,402 R332H probably damaging Het
Acrbp A C 6: 125,050,538 T50P probably damaging Het
Ahctf1 G T 1: 179,755,512 N1500K probably benign Het
Arfgef1 A G 1: 10,159,573 I1301T possibly damaging Het
Arhgef15 T C 11: 68,951,345 S478G probably benign Het
Armh1 T C 4: 117,237,780 D21G probably damaging Het
Atp13a4 A T 16: 29,408,961 L1045* probably null Het
Atp2a3 T A 11: 72,982,680 L793H probably damaging Het
B4galnt4 C A 7: 141,068,260 P563Q probably benign Het
BC027072 A G 17: 71,751,071 M537T probably damaging Het
Bcl2a1b A T 9: 89,199,660 K94* probably null Het
Bod1 T A 11: 31,666,853 Q136L possibly damaging Het
C2cd3 A G 7: 100,405,959 K443R probably damaging Het
Cadps A G 14: 12,411,588 V1250A possibly damaging Het
Car12 T A 9: 66,764,318 Y332* probably null Het
Ccdc186 A T 19: 56,802,000 probably null Het
Cdh6 T C 15: 13,034,688 T629A probably damaging Het
Cep112 T A 11: 108,506,645 D353E probably damaging Het
Cep152 T C 2: 125,586,381 S777G probably benign Het
Clec4b2 A C 6: 123,204,204 K183Q probably benign Het
Cngb3 T C 4: 19,395,926 Y323H probably benign Het
Cnp G T 11: 100,576,376 E48D probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp2d11 T A 15: 82,391,023 D241V probably benign Het
D5Ertd579e T A 5: 36,614,941 E703D probably damaging Het
Dlg1 T C 16: 31,857,946 V731A probably damaging Het
Dlgap5 T C 14: 47,413,819 S86G probably benign Het
Dock3 A G 9: 106,930,067 F1354L probably damaging Het
Dock3 C A 9: 106,992,972 V638F possibly damaging Het
E130309D02Rik A G 5: 143,301,837 S438P probably benign Het
Eif3c A T 7: 126,557,454 M407K probably benign Het
Epha4 T A 1: 77,390,075 K578* probably null Het
Erc2 C T 14: 27,653,328 L168F probably damaging Het
Esyt2 A G 12: 116,342,088 I313V probably benign Het
Far1 T A 7: 113,568,225 Y506N probably damaging Het
Fbxw26 T A 9: 109,717,969 N463Y possibly damaging Het
Fgg A G 3: 83,008,540 D96G probably benign Het
Gfer A G 17: 24,695,300 S130P probably damaging Het
Gm8994 A T 6: 136,328,739 Q66L possibly damaging Het
Hdac10 A T 15: 89,128,447 M1K probably null Het
Hsd3b1 A T 3: 98,853,326 S110R probably benign Het
Itga6 T C 2: 71,838,373 L552P possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc8a A G 2: 30,257,202 K676R probably benign Het
Lrrc8b A T 5: 105,480,214 Y142F probably benign Het
Lyz2 T A 10: 117,278,709 D105V possibly damaging Het
Mamdc4 T C 2: 25,570,023 D76G probably damaging Het
Map7d1 T C 4: 126,233,225 K731E unknown Het
Mgam A C 6: 40,643,054 I26L probably benign Het
Morc2a C T 11: 3,676,664 R241* probably null Het
Mtfmt C A 9: 65,452,104 H354N probably benign Het
Myh3 T C 11: 67,099,407 I1626T probably benign Het
Ndst1 A T 18: 60,691,987 V753D probably benign Het
Neurl4 A G 11: 69,903,171 D151G probably damaging Het
Nlrx1 T C 9: 44,256,897 S568G probably benign Het
Olfr1263 T C 2: 90,015,418 F163L probably damaging Het
Olfr1513 G C 14: 52,349,542 P168R probably damaging Het
Olfr315 T C 11: 58,778,306 Y60H possibly damaging Het
Olfr325 T G 11: 58,581,720 L292R probably damaging Het
Olfr593 A G 7: 103,212,540 I216V probably damaging Het
Olfr798 A T 10: 129,625,599 I154N probably benign Het
Olfr901 A T 9: 38,430,815 M178L probably benign Het
Osbpl7 A G 11: 97,060,150 I608V probably damaging Het
Pard3b T C 1: 61,768,000 I58T probably damaging Het
Pcdhga1 A C 18: 37,662,354 E137A possibly damaging Het
Pde6c G A 19: 38,150,624 V301I possibly damaging Het
Pdia5 G C 16: 35,410,416 N338K possibly damaging Het
Pex11g T C 8: 3,464,042 Y40C probably damaging Het
Plekhg3 A G 12: 76,564,125 Y183C probably damaging Het
Pole A C 5: 110,290,224 probably null Het
Ppfia1 A G 7: 144,491,576 L948P probably damaging Het
Prdm2 A T 4: 143,134,191 V843E probably damaging Het
Prss56 C A 1: 87,187,986 F527L probably damaging Het
Psmd11 T C 11: 80,438,320 L88P probably damaging Het
Ptx3 G C 3: 66,224,991 G311A probably damaging Het
Rars A T 11: 35,808,558 L636H probably damaging Het
Rnft2 A G 5: 118,237,442 S81P probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxra T A 2: 27,741,183 I142N probably damaging Het
Scin T C 12: 40,104,932 M221V probably benign Het
Sfmbt2 G A 2: 10,579,258 V809I possibly damaging Het
Sirt1 T A 10: 63,322,004 I505F probably benign Het
Six5 T C 7: 19,095,171 Y179H probably damaging Het
Slc12a4 A C 8: 105,944,609 M982R probably damaging Het
Slco4c1 T A 1: 96,837,512 L404F probably damaging Het
Smn1 T C 13: 100,132,423 L259P probably damaging Het
Sorl1 T G 9: 42,041,639 D702A probably damaging Het
Spta1 A G 1: 174,237,834 E1983G possibly damaging Het
Srsf1 T A 11: 88,049,962 probably null Het
Stard9 C T 2: 120,706,419 R4224* probably null Het
Svs1 A G 6: 48,987,717 T220A possibly damaging Het
Sybu T G 15: 44,675,499 M383L probably benign Het
Tbx15 A C 3: 99,352,267 N485H possibly damaging Het
Tcerg1l A T 7: 138,218,057 F485I probably damaging Het
Tdrd7 C A 4: 46,005,616 T474N possibly damaging Het
Thada A T 17: 84,448,042 probably null Het
Tnik A T 3: 28,650,086 I1020F probably damaging Het
Tnxb A G 17: 34,695,592 D1884G possibly damaging Het
Tprn T C 2: 25,268,833 M623T probably damaging Het
Trdn T A 10: 33,474,417 Y661N probably damaging Het
Ttc41 T C 10: 86,776,192 S1110P possibly damaging Het
Ttc6 A C 12: 57,660,240 R644S probably benign Het
Ttyh1 A T 7: 4,133,736 M448L probably benign Het
Unc79 G T 12: 103,161,820 C2250F probably damaging Het
Ush2a A G 1: 188,626,608 I2110M probably benign Het
Uvssa G T 5: 33,413,913 E634* probably null Het
Vac14 A C 8: 110,645,808 T384P probably benign Het
Wdr11 A G 7: 129,633,721 E1169G probably benign Het
Zfp36l1 T A 12: 80,110,524 T28S probably benign Het
Zfp715 A T 7: 43,299,682 Y285N possibly damaging Het
Zfp91 A T 19: 12,770,060 D566E probably damaging Het
Zgrf1 G A 3: 127,602,436 V544M probably damaging Het
Other mutations in Mmp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Mmp13 APN 9 7278974 splice site probably benign
IGL02027:Mmp13 APN 9 7272955 missense probably damaging 1.00
IGL02320:Mmp13 APN 9 7278941 missense probably benign 0.00
R0143:Mmp13 UTSW 9 7276558 missense probably damaging 1.00
R0417:Mmp13 UTSW 9 7276602 missense probably benign
R0505:Mmp13 UTSW 9 7272929 missense probably damaging 1.00
R0624:Mmp13 UTSW 9 7280221 missense possibly damaging 0.69
R0632:Mmp13 UTSW 9 7274032 missense probably damaging 1.00
R0632:Mmp13 UTSW 9 7282077 missense possibly damaging 0.74
R1102:Mmp13 UTSW 9 7272952 missense possibly damaging 0.55
R1387:Mmp13 UTSW 9 7282033 missense possibly damaging 0.60
R1478:Mmp13 UTSW 9 7272892 missense probably damaging 1.00
R1669:Mmp13 UTSW 9 7277926 missense probably benign 0.01
R4647:Mmp13 UTSW 9 7274233 missense probably damaging 1.00
R4648:Mmp13 UTSW 9 7274233 missense probably damaging 1.00
R4668:Mmp13 UTSW 9 7272580 missense possibly damaging 0.54
R4827:Mmp13 UTSW 9 7278880 missense possibly damaging 0.68
R5780:Mmp13 UTSW 9 7278952 missense possibly damaging 0.76
R5946:Mmp13 UTSW 9 7276580 missense probably damaging 1.00
R5996:Mmp13 UTSW 9 7274269 missense probably damaging 1.00
R6102:Mmp13 UTSW 9 7276688 missense probably benign 0.07
R6693:Mmp13 UTSW 9 7280245 missense probably benign 0.00
R6789:Mmp13 UTSW 9 7272781 missense probably benign 0.00
R7310:Mmp13 UTSW 9 7280880 missense possibly damaging 0.60
R7728:Mmp13 UTSW 9 7274004 missense probably benign
R8041:Mmp13 UTSW 9 7280865 missense probably benign 0.13
R8314:Mmp13 UTSW 9 7272931 missense probably damaging 1.00
R8324:Mmp13 UTSW 9 7276636 missense possibly damaging 0.75
T0722:Mmp13 UTSW 9 7280857 missense possibly damaging 0.67
Z1177:Mmp13 UTSW 9 7277953 missense probably damaging 1.00
Z1177:Mmp13 UTSW 9 7280200 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGAAATCATACTACCATCCTGCG -3'
(R):5'- AATAATGTTGGGGCTAGCATTGAG -3'

Sequencing Primer
(F):5'- GACTCTTGCGGGAATCCTGAAG -3'
(R):5'- TGGGGCTAGCATTGAGATAATAGGTC -3'
Posted On2016-03-17