Mutagenetix > Incidental Mutation

Incidental Mutation 'R4898:Sorl1'

375918

Institutional Source

Beutler Lab

Gene Symbol

Sorl1

Ensembl Gene

ENSMUSG00000049313

Gene Name

sortilin-related receptor, LDLR class A repeats-containing

Synonyms

2900010L19Rik, mSorLA, Sorla, LR11

MMRRC Submission

042502-MU

Accession Numbers

Genbank: NM_011436; MGI: 1202296

Essential gene?

Probably non essential (E-score: 0.213) question?

Stock #

R4898 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

41964720-42124297 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 42041639 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Alanine at position 702 (D702A)

Ref Sequence

ENSEMBL: ENSMUSP00000058613 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000060989]

AlphaFold

O88307

Predicted Effect

probably damaging
Transcript: ENSMUST00000060989
AA Change: D702A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000058613
Gene: ENSMUSG00000049313
AA Change: D702A

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
VPS10	124	757	N/A	SMART
LY	780	822	9.33e-6	SMART
LY	824	866	2.38e-12	SMART
LY	867	912	1.87e-5	SMART
LY	913	953	1.08e-10	SMART
LY	954	993	5.43e0	SMART
EGF_like	1020	1072	2.8e1	SMART
LDLa	1077	1114	1.76e-14	SMART
LDLa	1116	1155	5.34e-14	SMART
LDLa	1157	1194	1.67e-15	SMART
EGF_like	1198	1236	4.93e1	SMART
LDLa	1198	1237	3.83e-15	SMART
LDLa	1238	1273	1.99e-13	SMART
LDLa	1274	1317	2.53e-6	SMART
LDLa	1324	1361	4.34e-14	SMART
LDLa	1367	1405	1.14e-13	SMART
LDLa	1418	1455	3.34e-15	SMART
LDLa	1470	1508	1.09e-10	SMART
LDLa	1513	1551	1.09e-10	SMART
FN3	1555	1638	4.19e-4	SMART
FN3	1651	1732	7.23e-8	SMART
FN3	1747	1830	4.8e0	SMART
FN3	1842	1920	3e1	SMART
FN3	1933	2016	6.01e-5	SMART
FN3	2025	2107	2.03e-2	SMART
transmembrane domain	2137	2159	N/A	INTRINSIC
low complexity region	2188	2199	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.5%
10x: 96.8%
20x: 93.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mosaic protein that belongs to at least two families: the vacuolar protein sorting 10 (VPS10) domain-containing receptor family, and the low density lipoprotein receptor (LDLR) family. The encoded protein also contains fibronectin type III repeats and an epidermal growth factor repeat. The encoded preproprotein is proteolytically processed to generate the mature receptor, which likely plays roles in endocytosis and sorting. Mutations in this gene may be associated with Alzheimer's disease. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous mutation of this gene results in decreased femoral artery intimal thickness after cuff placement and abolished angiotensin II stimulated vascular smooth muscle migration and attachment. Two other alleles show an increase in beta-amyloid deposits or peptide in the brain. [provided by MGI curators]

Allele List at MGI

All alleles(15) : Targeted, knock-out(2) Gene trapped(13)

Other mutations in this stock

Total: 116 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcc6	T	C	7: 45,989,687	Y944C	probably damaging	Het
Acacb	T	C	5: 114,232,938	V1747A	probably benign	Het
Acad8	C	T	9: 26,978,402	R332H	probably damaging	Het
Acrbp	A	C	6: 125,050,538	T50P	probably damaging	Het
Ahctf1	G	T	1: 179,755,512	N1500K	probably benign	Het
Arfgef1	A	G	1: 10,159,573	I1301T	possibly damaging	Het
Arhgef15	T	C	11: 68,951,345	S478G	probably benign	Het
Armh1	T	C	4: 117,237,780	D21G	probably damaging	Het
Atp13a4	A	T	16: 29,408,961	L1045*	probably null	Het
Atp2a3	T	A	11: 72,982,680	L793H	probably damaging	Het
B4galnt4	C	A	7: 141,068,260	P563Q	probably benign	Het
BC027072	A	G	17: 71,751,071	M537T	probably damaging	Het
Bcl2a1b	A	T	9: 89,199,660	K94*	probably null	Het
Bod1	T	A	11: 31,666,853	Q136L	possibly damaging	Het
C2cd3	A	G	7: 100,405,959	K443R	probably damaging	Het
Cadps	A	G	14: 12,411,588	V1250A	possibly damaging	Het
Car12	T	A	9: 66,764,318	Y332*	probably null	Het
Ccdc186	A	T	19: 56,802,000		probably null	Het
Cdh6	T	C	15: 13,034,688	T629A	probably damaging	Het
Cep112	T	A	11: 108,506,645	D353E	probably damaging	Het
Cep152	T	C	2: 125,586,381	S777G	probably benign	Het
Clec4b2	A	C	6: 123,204,204	K183Q	probably benign	Het
Cngb3	T	C	4: 19,395,926	Y323H	probably benign	Het
Cnp	G	T	11: 100,576,376	E48D	probably benign	Het
Ctrb1	T	A	8: 111,687,151	I194F	probably benign	Het
Cyp2d11	T	A	15: 82,391,023	D241V	probably benign	Het
D5Ertd579e	T	A	5: 36,614,941	E703D	probably damaging	Het
Dlg1	T	C	16: 31,857,946	V731A	probably damaging	Het
Dlgap5	T	C	14: 47,413,819	S86G	probably benign	Het
Dock3	A	G	9: 106,930,067	F1354L	probably damaging	Het
Dock3	C	A	9: 106,992,972	V638F	possibly damaging	Het
E130309D02Rik	A	G	5: 143,301,837	S438P	probably benign	Het
Eif3c	A	T	7: 126,557,454	M407K	probably benign	Het
Epha4	T	A	1: 77,390,075	K578*	probably null	Het
Erc2	C	T	14: 27,653,328	L168F	probably damaging	Het
Esyt2	A	G	12: 116,342,088	I313V	probably benign	Het
Far1	T	A	7: 113,568,225	Y506N	probably damaging	Het
Fbxw26	T	A	9: 109,717,969	N463Y	possibly damaging	Het
Fgg	A	G	3: 83,008,540	D96G	probably benign	Het
Gfer	A	G	17: 24,695,300	S130P	probably damaging	Het
Gm8994	A	T	6: 136,328,739	Q66L	possibly damaging	Het
Hdac10	A	T	15: 89,128,447	M1K	probably null	Het
Hsd3b1	A	T	3: 98,853,326	S110R	probably benign	Het
Itga6	T	C	2: 71,838,373	L552P	possibly damaging	Het
Klk14	G	A	7: 43,692,077	C51Y	probably damaging	Het
Lama2	TTTGCGCATT	TTT	10: 27,043,643		probably null	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Lrrc8a	A	G	2: 30,257,202	K676R	probably benign	Het
Lrrc8b	A	T	5: 105,480,214	Y142F	probably benign	Het
Lyz2	T	A	10: 117,278,709	D105V	possibly damaging	Het
Mamdc4	T	C	2: 25,570,023	D76G	probably damaging	Het
Map7d1	T	C	4: 126,233,225	K731E	unknown	Het
Mgam	A	C	6: 40,643,054	I26L	probably benign	Het
Mmp13	A	T	9: 7,272,953	E104D	probably benign	Het
Morc2a	C	T	11: 3,676,664	R241*	probably null	Het
Mtfmt	C	A	9: 65,452,104	H354N	probably benign	Het
Myh3	T	C	11: 67,099,407	I1626T	probably benign	Het
Ndst1	A	T	18: 60,691,987	V753D	probably benign	Het
Neurl4	A	G	11: 69,903,171	D151G	probably damaging	Het
Nlrx1	T	C	9: 44,256,897	S568G	probably benign	Het
Olfr1263	T	C	2: 90,015,418	F163L	probably damaging	Het
Olfr1513	G	C	14: 52,349,542	P168R	probably damaging	Het
Olfr315	T	C	11: 58,778,306	Y60H	possibly damaging	Het
Olfr325	T	G	11: 58,581,720	L292R	probably damaging	Het
Olfr593	A	G	7: 103,212,540	I216V	probably damaging	Het
Olfr798	A	T	10: 129,625,599	I154N	probably benign	Het
Olfr901	A	T	9: 38,430,815	M178L	probably benign	Het
Osbpl7	A	G	11: 97,060,150	I608V	probably damaging	Het
Pard3b	T	C	1: 61,768,000	I58T	probably damaging	Het
Pcdhga1	A	C	18: 37,662,354	E137A	possibly damaging	Het
Pde6c	G	A	19: 38,150,624	V301I	possibly damaging	Het
Pdia5	G	C	16: 35,410,416	N338K	possibly damaging	Het
Pex11g	T	C	8: 3,464,042	Y40C	probably damaging	Het
Plekhg3	A	G	12: 76,564,125	Y183C	probably damaging	Het
Pole	A	C	5: 110,290,224		probably null	Het
Ppfia1	A	G	7: 144,491,576	L948P	probably damaging	Het
Prdm2	A	T	4: 143,134,191	V843E	probably damaging	Het
Prss56	C	A	1: 87,187,986	F527L	probably damaging	Het
Psmd11	T	C	11: 80,438,320	L88P	probably damaging	Het
Ptx3	G	C	3: 66,224,991	G311A	probably damaging	Het
Rars	A	T	11: 35,808,558	L636H	probably damaging	Het
Rnft2	A	G	5: 118,237,442	S81P	probably benign	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Rxra	T	A	2: 27,741,183	I142N	probably damaging	Het
Scin	T	C	12: 40,104,932	M221V	probably benign	Het
Sfmbt2	G	A	2: 10,579,258	V809I	possibly damaging	Het
Sirt1	T	A	10: 63,322,004	I505F	probably benign	Het
Six5	T	C	7: 19,095,171	Y179H	probably damaging	Het
Slc12a4	A	C	8: 105,944,609	M982R	probably damaging	Het
Slco4c1	T	A	1: 96,837,512	L404F	probably damaging	Het
Smn1	T	C	13: 100,132,423	L259P	probably damaging	Het
Spta1	A	G	1: 174,237,834	E1983G	possibly damaging	Het
Srsf1	T	A	11: 88,049,962		probably null	Het
Stard9	C	T	2: 120,706,419	R4224*	probably null	Het
Svs1	A	G	6: 48,987,717	T220A	possibly damaging	Het
Sybu	T	G	15: 44,675,499	M383L	probably benign	Het
Tbx15	A	C	3: 99,352,267	N485H	possibly damaging	Het
Tcerg1l	A	T	7: 138,218,057	F485I	probably damaging	Het
Tdrd7	C	A	4: 46,005,616	T474N	possibly damaging	Het
Thada	A	T	17: 84,448,042		probably null	Het
Tnik	A	T	3: 28,650,086	I1020F	probably damaging	Het
Tnxb	A	G	17: 34,695,592	D1884G	possibly damaging	Het
Tprn	T	C	2: 25,268,833	M623T	probably damaging	Het
Trdn	T	A	10: 33,474,417	Y661N	probably damaging	Het
Ttc41	T	C	10: 86,776,192	S1110P	possibly damaging	Het
Ttc6	A	C	12: 57,660,240	R644S	probably benign	Het
Ttyh1	A	T	7: 4,133,736	M448L	probably benign	Het
Unc79	G	T	12: 103,161,820	C2250F	probably damaging	Het
Ush2a	A	G	1: 188,626,608	I2110M	probably benign	Het
Uvssa	G	T	5: 33,413,913	E634*	probably null	Het
Vac14	A	C	8: 110,645,808	T384P	probably benign	Het
Wdr11	A	G	7: 129,633,721	E1169G	probably benign	Het
Zfp36l1	T	A	12: 80,110,524	T28S	probably benign	Het
Zfp715	A	T	7: 43,299,682	Y285N	possibly damaging	Het
Zfp91	A	T	19: 12,770,060	D566E	probably damaging	Het
Zgrf1	G	A	3: 127,602,436	V544M	probably damaging	Het

Other mutations in Sorl1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Sorl1	APN	9	41974094	missense	probably damaging	1.00
IGL01303:Sorl1	APN	9	42024478	splice site	probably benign
IGL01545:Sorl1	APN	9	42043956	missense	probably damaging	1.00
IGL01629:Sorl1	APN	9	42057269	critical splice donor site	probably null
IGL01670:Sorl1	APN	9	42001492	missense	possibly damaging	0.81
IGL01684:Sorl1	APN	9	41980711	missense	probably damaging	0.96
IGL02154:Sorl1	APN	9	42004034	missense	probably benign
IGL02215:Sorl1	APN	9	42018182	missense	probably damaging	0.97
IGL02427:Sorl1	APN	9	42041690	missense	probably damaging	1.00
IGL02590:Sorl1	APN	9	42046561	missense	probably benign	0.01
IGL02794:Sorl1	APN	9	42063774	missense	probably damaging	0.98
IGL02797:Sorl1	APN	9	42037059	missense	probably damaging	0.99
IGL02987:Sorl1	APN	9	42041053	missense	probably damaging	1.00
IGL03005:Sorl1	APN	9	42057325	missense	probably damaging	1.00
IGL03069:Sorl1	APN	9	41991426	missense	probably benign
IGL03288:Sorl1	APN	9	42033562	splice site	probably benign
N/A - 287:Sorl1	UTSW	9	42041596	nonsense	probably null
PIT4151001:Sorl1	UTSW	9	41968622	missense	probably damaging	1.00
R0117:Sorl1	UTSW	9	42033577	missense	probably benign	0.10
R0173:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R0318:Sorl1	UTSW	9	42081954	missense	probably damaging	1.00
R0385:Sorl1	UTSW	9	42031909	missense	probably damaging	0.99
R0448:Sorl1	UTSW	9	42004088	missense	probably damaging	1.00
R0492:Sorl1	UTSW	9	41991371	missense	probably null	0.00
R0512:Sorl1	UTSW	9	42067832	missense	probably benign	0.01
R0587:Sorl1	UTSW	9	41984506	missense	probably damaging	1.00
R0600:Sorl1	UTSW	9	42043900	splice site	probably benign
R0831:Sorl1	UTSW	9	42071069	splice site	probably benign
R0924:Sorl1	UTSW	9	42008174	splice site	probably benign
R1013:Sorl1	UTSW	9	42002559	missense	probably benign	0.00
R1053:Sorl1	UTSW	9	41991456	missense	probably benign
R1077:Sorl1	UTSW	9	42014490	missense	probably damaging	1.00
R1326:Sorl1	UTSW	9	42031796	missense	probably benign	0.14
R1348:Sorl1	UTSW	9	42000412	splice site	probably null
R1498:Sorl1	UTSW	9	42041073	missense	probably damaging	1.00
R1671:Sorl1	UTSW	9	41974000	missense	probably damaging	1.00
R1713:Sorl1	UTSW	9	41996242	missense	probably benign	0.06
R1738:Sorl1	UTSW	9	42089965	missense	probably benign	0.33
R1779:Sorl1	UTSW	9	41991482	critical splice acceptor site	probably null
R1871:Sorl1	UTSW	9	41969725	nonsense	probably null
R1912:Sorl1	UTSW	9	42081950	missense	probably damaging	1.00
R1952:Sorl1	UTSW	9	42046624	missense	probably benign
R2071:Sorl1	UTSW	9	41979457	missense	possibly damaging	0.71
R2153:Sorl1	UTSW	9	41984492	missense	probably benign	0.01
R2417:Sorl1	UTSW	9	41980711	missense	probably damaging	0.96
R2429:Sorl1	UTSW	9	42037070	missense	probably damaging	1.00
R2866:Sorl1	UTSW	9	41969781	missense	probably benign
R3815:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3816:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3817:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3819:Sorl1	UTSW	9	42064049	missense	possibly damaging	0.71
R3890:Sorl1	UTSW	9	42004105	missense	probably damaging	1.00
R3941:Sorl1	UTSW	9	41989468	critical splice acceptor site	probably null
R4409:Sorl1	UTSW	9	42035448	missense	probably damaging	0.99
R4410:Sorl1	UTSW	9	42003992	nonsense	probably null
R4610:Sorl1	UTSW	9	42031914	missense	possibly damaging	0.65
R4664:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4666:Sorl1	UTSW	9	42004051	missense	probably damaging	0.97
R4668:Sorl1	UTSW	9	41984508	missense	probably damaging	1.00
R4823:Sorl1	UTSW	9	41992321	missense	probably damaging	1.00
R4874:Sorl1	UTSW	9	42063752	missense	probably damaging	0.99
R4922:Sorl1	UTSW	9	42014450	splice site	probably null
R4976:Sorl1	UTSW	9	41983003	missense	probably benign	0.00
R4984:Sorl1	UTSW	9	41991342	missense	probably damaging	1.00
R5046:Sorl1	UTSW	9	41996294	missense	probably benign
R5070:Sorl1	UTSW	9	42031818	missense	possibly damaging	0.82
R5084:Sorl1	UTSW	9	41976377	missense	probably benign	0.01
R5202:Sorl1	UTSW	9	42033583	missense	probably benign	0.00
R5265:Sorl1	UTSW	9	42106516	missense	possibly damaging	0.80
R5275:Sorl1	UTSW	9	42030902	missense	probably benign	0.33
R5368:Sorl1	UTSW	9	41979390	missense	probably benign	0.00
R5385:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5386:Sorl1	UTSW	9	42057284	missense	possibly damaging	0.83
R5416:Sorl1	UTSW	9	42002636	nonsense	probably null
R5518:Sorl1	UTSW	9	42037212	missense	possibly damaging	0.92
R5545:Sorl1	UTSW	9	41991625	missense	probably benign	0.08
R5864:Sorl1	UTSW	9	42092373	missense	probably damaging	1.00
R5865:Sorl1	UTSW	9	41983034	missense	possibly damaging	0.94
R6339:Sorl1	UTSW	9	41969742	missense	probably benign	0.10
R6484:Sorl1	UTSW	9	41976407	missense	probably damaging	1.00
R6505:Sorl1	UTSW	9	42071234	missense	probably damaging	1.00
R6591:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6596:Sorl1	UTSW	9	42001603	missense	possibly damaging	0.81
R6654:Sorl1	UTSW	9	41980645	missense	possibly damaging	0.47
R6691:Sorl1	UTSW	9	42002567	missense	probably damaging	1.00
R6702:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6703:Sorl1	UTSW	9	42071201	missense	probably damaging	0.97
R6775:Sorl1	UTSW	9	42092452	missense	possibly damaging	0.93
R6792:Sorl1	UTSW	9	42099263	missense	probably damaging	1.00
R6852:Sorl1	UTSW	9	42024398	missense	possibly damaging	0.90
R6860:Sorl1	UTSW	9	42022392	missense	probably benign	0.01
R6925:Sorl1	UTSW	9	42033626	missense	probably damaging	1.00
R7022:Sorl1	UTSW	9	41969751	missense	probably benign	0.11
R7033:Sorl1	UTSW	9	42030983	missense	possibly damaging	0.93
R7091:Sorl1	UTSW	9	42002634	missense	probably benign	0.00
R7267:Sorl1	UTSW	9	42124079	missense	possibly damaging	0.63
R7269:Sorl1	UTSW	9	42037203	missense	probably damaging	0.99
R7272:Sorl1	UTSW	9	42063710	splice site	probably null
R7537:Sorl1	UTSW	9	41980688	missense	probably benign	0.01
R7615:Sorl1	UTSW	9	41977582	missense	possibly damaging	0.91
R7636:Sorl1	UTSW	9	42092334	missense	possibly damaging	0.90
R7727:Sorl1	UTSW	9	41984526	missense	probably damaging	1.00
R7763:Sorl1	UTSW	9	42043909	missense	probably damaging	1.00
R7831:Sorl1	UTSW	9	42089961	missense	probably benign	0.17
R7956:Sorl1	UTSW	9	41989359	missense	probably damaging	1.00
R7964:Sorl1	UTSW	9	41991401	missense	probably damaging	1.00
R7977:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R7987:Sorl1	UTSW	9	41977561	missense	probably damaging	1.00
R8151:Sorl1	UTSW	9	42067933	missense	probably damaging	0.99
R8219:Sorl1	UTSW	9	42041561	splice site	probably null
R8261:Sorl1	UTSW	9	42014481	missense	probably damaging	1.00
R8283:Sorl1	UTSW	9	42030998	missense	probably damaging	1.00
R8308:Sorl1	UTSW	9	42018160	missense	probably damaging	1.00
R8348:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8448:Sorl1	UTSW	9	41991745	missense	probably benign	0.35
R8524:Sorl1	UTSW	9	41974074	missense	probably damaging	1.00
R8869:Sorl1	UTSW	9	42022426	missense	probably benign	0.01
R8898:Sorl1	UTSW	9	42000271	missense	probably damaging	1.00
R8972:Sorl1	UTSW	9	42046552	missense	probably damaging	1.00
R9012:Sorl1	UTSW	9	42071195	missense	probably damaging	1.00
R9094:Sorl1	UTSW	9	42063754	missense	possibly damaging	0.92
R9241:Sorl1	UTSW	9	41974124	nonsense	probably null
R9278:Sorl1	UTSW	9	42046561	missense	probably benign	0.01
R9288:Sorl1	UTSW	9	42041631	missense	probably damaging	1.00
R9303:Sorl1	UTSW	9	41989443	missense	probably damaging	1.00
R9330:Sorl1	UTSW	9	42067933	missense	probably damaging	1.00
R9332:Sorl1	UTSW	9	42001518	missense	probably damaging	1.00
R9468:Sorl1	UTSW	9	42124088	missense	probably benign	0.20
R9528:Sorl1	UTSW	9	42022335	critical splice donor site	probably null
R9544:Sorl1	UTSW	9	42081809	nonsense	probably null
R9563:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9564:Sorl1	UTSW	9	42046597	missense	probably damaging	1.00
R9588:Sorl1	UTSW	9	42081809	nonsense	probably null
R9634:Sorl1	UTSW	9	41996294	missense	probably benign
R9671:Sorl1	UTSW	9	42031781	missense	possibly damaging	0.85
R9701:Sorl1	UTSW	9	42092470	missense	probably damaging	1.00
Z1176:Sorl1	UTSW	9	42099203	missense	possibly damaging	0.64
Z1176:Sorl1	UTSW	9	42123948	missense	probably benign	0.03
Z1177:Sorl1	UTSW	9	41991638	missense	possibly damaging	0.92
Z1177:Sorl1	UTSW	9	42106541	missense	probably benign	0.00
Z1177:Sorl1	UTSW	9	42123912	missense	probably damaging	1.00
Z31818:Sorl1	UTSW	9	42041596	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- ACCTGCCCTCTGTAACTTGG -3'
(R):5'- GCTCTGACACATGGCTTCTTTG -3'

Sequencing Primer
(F):5'- CCCTCTGTAACTTGGGGTTTGAG -3'
(R):5'- TACCAAATAGCGGTCCTGTG -3'

Posted On

2016-03-17