Incidental Mutation 'R4898:Lama2'
ID375928
Institutional Source Beutler Lab
Gene Symbol Lama2
Ensembl Gene ENSMUSG00000019899
Gene Namelaminin, alpha 2
Synonymsmerosin, mer
MMRRC Submission 042502-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.424) question?
Stock #R4898 (G1)
Quality Score217
Status Not validated
Chromosome10
Chromosomal Location26980036-27619758 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TTTGCGCATT to TTT at 27043643 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000092639]
Predicted Effect probably null
Transcript: ENSMUST00000092639
SMART Domains Protein: ENSMUSP00000090304
Gene: ENSMUSG00000019899

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
LamNT 29 281 5.35e-129 SMART
EGF_Lam 283 337 2.11e-4 SMART
EGF_Lam 340 407 1.59e-8 SMART
EGF_Lam 410 462 5.44e-7 SMART
EGF_Lam 465 511 9.05e-4 SMART
LamB 574 706 2.26e-44 SMART
Pfam:Laminin_EGF 715 745 2.8e-4 PFAM
EGF_Lam 753 800 4.03e-10 SMART
EGF_Lam 803 858 3.01e-9 SMART
EGF_Lam 861 911 1.35e-11 SMART
EGF_Lam 914 960 7.23e-12 SMART
EGF_Lam 963 1007 5.87e-12 SMART
EGF_Lam 1010 1053 1.28e-12 SMART
EGF_Lam 1056 1099 2.37e-7 SMART
EGF_Lam 1102 1159 3.22e-9 SMART
LamB 1225 1360 1.95e-57 SMART
EGF_like 1364 1413 8.13e-1 SMART
EGF_Lam 1416 1462 5.48e-12 SMART
EGF_Lam 1465 1520 1.27e-7 SMART
EGF_Lam 1523 1567 2.4e-8 SMART
Pfam:Laminin_I 1584 1849 2e-92 PFAM
Blast:MA 1881 2113 1e-112 BLAST
LamG 2162 2307 1.28e-25 SMART
LamG 2356 2500 2.2e-33 SMART
LamG 2542 2688 3.31e-28 SMART
low complexity region 2725 2741 N/A INTRINSIC
LamG 2781 2914 2.25e-39 SMART
LamG 2956 3092 1.53e-32 SMART
Predicted Effect probably null
Transcript: ENSMUST00000219763
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Laminin, an extracellular protein, is a major component of the basement membrane. It is thought to mediate the attachment, migration, and organization of cells into tissues during embryonic development by interacting with other extracellular matrix components. It is composed of three subunits, alpha, beta, and gamma, which are bound to each other by disulfide bonds into a cross-shaped molecule. This gene encodes the alpha 2 chain, which constitutes one of the subunits of laminin 2 (merosin) and laminin 4 (s-merosin). Mutations in this gene have been identified as the cause of congenital merosin-deficient muscular dystrophy. Two transcript variants encoding different proteins have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted and spontaneous mutations exhibit progressive growth retardation, ataxia, muscle atrophy and degeneration, infertility, and premature lethality. Muscle fiber degeneration is evident as early as the first week of life. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,989,687 Y944C probably damaging Het
Acacb T C 5: 114,232,938 V1747A probably benign Het
Acad8 C T 9: 26,978,402 R332H probably damaging Het
Acrbp A C 6: 125,050,538 T50P probably damaging Het
Ahctf1 G T 1: 179,755,512 N1500K probably benign Het
Arfgef1 A G 1: 10,159,573 I1301T possibly damaging Het
Arhgef15 T C 11: 68,951,345 S478G probably benign Het
Armh1 T C 4: 117,237,780 D21G probably damaging Het
Atp13a4 A T 16: 29,408,961 L1045* probably null Het
Atp2a3 T A 11: 72,982,680 L793H probably damaging Het
B4galnt4 C A 7: 141,068,260 P563Q probably benign Het
BC027072 A G 17: 71,751,071 M537T probably damaging Het
Bcl2a1b A T 9: 89,199,660 K94* probably null Het
Bod1 T A 11: 31,666,853 Q136L possibly damaging Het
C2cd3 A G 7: 100,405,959 K443R probably damaging Het
Cadps A G 14: 12,411,588 V1250A possibly damaging Het
Car12 T A 9: 66,764,318 Y332* probably null Het
Ccdc186 A T 19: 56,802,000 probably null Het
Cdh6 T C 15: 13,034,688 T629A probably damaging Het
Cep112 T A 11: 108,506,645 D353E probably damaging Het
Cep152 T C 2: 125,586,381 S777G probably benign Het
Clec4b2 A C 6: 123,204,204 K183Q probably benign Het
Cngb3 T C 4: 19,395,926 Y323H probably benign Het
Cnp G T 11: 100,576,376 E48D probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp2d11 T A 15: 82,391,023 D241V probably benign Het
D5Ertd579e T A 5: 36,614,941 E703D probably damaging Het
Dlg1 T C 16: 31,857,946 V731A probably damaging Het
Dlgap5 T C 14: 47,413,819 S86G probably benign Het
Dock3 A G 9: 106,930,067 F1354L probably damaging Het
Dock3 C A 9: 106,992,972 V638F possibly damaging Het
E130309D02Rik A G 5: 143,301,837 S438P probably benign Het
Eif3c A T 7: 126,557,454 M407K probably benign Het
Epha4 T A 1: 77,390,075 K578* probably null Het
Erc2 C T 14: 27,653,328 L168F probably damaging Het
Esyt2 A G 12: 116,342,088 I313V probably benign Het
Far1 T A 7: 113,568,225 Y506N probably damaging Het
Fbxw26 T A 9: 109,717,969 N463Y possibly damaging Het
Fgg A G 3: 83,008,540 D96G probably benign Het
Gfer A G 17: 24,695,300 S130P probably damaging Het
Gm8994 A T 6: 136,328,739 Q66L possibly damaging Het
Hdac10 A T 15: 89,128,447 M1K probably null Het
Hsd3b1 A T 3: 98,853,326 S110R probably benign Het
Itga6 T C 2: 71,838,373 L552P possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc8a A G 2: 30,257,202 K676R probably benign Het
Lrrc8b A T 5: 105,480,214 Y142F probably benign Het
Lyz2 T A 10: 117,278,709 D105V possibly damaging Het
Mamdc4 T C 2: 25,570,023 D76G probably damaging Het
Map7d1 T C 4: 126,233,225 K731E unknown Het
Mgam A C 6: 40,643,054 I26L probably benign Het
Mmp13 A T 9: 7,272,953 E104D probably benign Het
Morc2a C T 11: 3,676,664 R241* probably null Het
Mtfmt C A 9: 65,452,104 H354N probably benign Het
Myh3 T C 11: 67,099,407 I1626T probably benign Het
Ndst1 A T 18: 60,691,987 V753D probably benign Het
Neurl4 A G 11: 69,903,171 D151G probably damaging Het
Nlrx1 T C 9: 44,256,897 S568G probably benign Het
Olfr1263 T C 2: 90,015,418 F163L probably damaging Het
Olfr1513 G C 14: 52,349,542 P168R probably damaging Het
Olfr315 T C 11: 58,778,306 Y60H possibly damaging Het
Olfr325 T G 11: 58,581,720 L292R probably damaging Het
Olfr593 A G 7: 103,212,540 I216V probably damaging Het
Olfr798 A T 10: 129,625,599 I154N probably benign Het
Olfr901 A T 9: 38,430,815 M178L probably benign Het
Osbpl7 A G 11: 97,060,150 I608V probably damaging Het
Pard3b T C 1: 61,768,000 I58T probably damaging Het
Pcdhga1 A C 18: 37,662,354 E137A possibly damaging Het
Pde6c G A 19: 38,150,624 V301I possibly damaging Het
Pdia5 G C 16: 35,410,416 N338K possibly damaging Het
Pex11g T C 8: 3,464,042 Y40C probably damaging Het
Plekhg3 A G 12: 76,564,125 Y183C probably damaging Het
Pole A C 5: 110,290,224 probably null Het
Ppfia1 A G 7: 144,491,576 L948P probably damaging Het
Prdm2 A T 4: 143,134,191 V843E probably damaging Het
Prss56 C A 1: 87,187,986 F527L probably damaging Het
Psmd11 T C 11: 80,438,320 L88P probably damaging Het
Ptx3 G C 3: 66,224,991 G311A probably damaging Het
Rars A T 11: 35,808,558 L636H probably damaging Het
Rnft2 A G 5: 118,237,442 S81P probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxra T A 2: 27,741,183 I142N probably damaging Het
Scin T C 12: 40,104,932 M221V probably benign Het
Sfmbt2 G A 2: 10,579,258 V809I possibly damaging Het
Sirt1 T A 10: 63,322,004 I505F probably benign Het
Six5 T C 7: 19,095,171 Y179H probably damaging Het
Slc12a4 A C 8: 105,944,609 M982R probably damaging Het
Slco4c1 T A 1: 96,837,512 L404F probably damaging Het
Smn1 T C 13: 100,132,423 L259P probably damaging Het
Sorl1 T G 9: 42,041,639 D702A probably damaging Het
Spta1 A G 1: 174,237,834 E1983G possibly damaging Het
Srsf1 T A 11: 88,049,962 probably null Het
Stard9 C T 2: 120,706,419 R4224* probably null Het
Svs1 A G 6: 48,987,717 T220A possibly damaging Het
Sybu T G 15: 44,675,499 M383L probably benign Het
Tbx15 A C 3: 99,352,267 N485H possibly damaging Het
Tcerg1l A T 7: 138,218,057 F485I probably damaging Het
Tdrd7 C A 4: 46,005,616 T474N possibly damaging Het
Thada A T 17: 84,448,042 probably null Het
Tnik A T 3: 28,650,086 I1020F probably damaging Het
Tnxb A G 17: 34,695,592 D1884G possibly damaging Het
Tprn T C 2: 25,268,833 M623T probably damaging Het
Trdn T A 10: 33,474,417 Y661N probably damaging Het
Ttc41 T C 10: 86,776,192 S1110P possibly damaging Het
Ttc6 A C 12: 57,660,240 R644S probably benign Het
Ttyh1 A T 7: 4,133,736 M448L probably benign Het
Unc79 G T 12: 103,161,820 C2250F probably damaging Het
Ush2a A G 1: 188,626,608 I2110M probably benign Het
Uvssa G T 5: 33,413,913 E634* probably null Het
Vac14 A C 8: 110,645,808 T384P probably benign Het
Wdr11 A G 7: 129,633,721 E1169G probably benign Het
Zfp36l1 T A 12: 80,110,524 T28S probably benign Het
Zfp715 A T 7: 43,299,682 Y285N possibly damaging Het
Zfp91 A T 19: 12,770,060 D566E probably damaging Het
Zgrf1 G A 3: 127,602,436 V544M probably damaging Het
Other mutations in Lama2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Lama2 APN 10 27188265 missense probably benign 0.01
IGL00467:Lama2 APN 10 27467197 splice site probably benign
IGL00470:Lama2 APN 10 27243742 missense probably benign 0.22
IGL00517:Lama2 APN 10 27197330 missense probably benign 0.01
IGL00541:Lama2 APN 10 27188306 missense probably benign 0.14
IGL00931:Lama2 APN 10 27006776 missense possibly damaging 0.92
IGL00951:Lama2 APN 10 27030285 missense probably benign 0.03
IGL00988:Lama2 APN 10 27369015 nonsense probably null
IGL01098:Lama2 APN 10 27031112 missense possibly damaging 0.66
IGL01152:Lama2 APN 10 27208429 missense probably benign 0.00
IGL01293:Lama2 APN 10 27231636 missense probably benign 0.38
IGL01338:Lama2 APN 10 27188272 missense probably benign 0.13
IGL01609:Lama2 APN 10 27344421 missense probably benign 0.03
IGL01643:Lama2 APN 10 27070372 splice site probably benign
IGL01675:Lama2 APN 10 27188054 missense possibly damaging 0.77
IGL01681:Lama2 APN 10 27265045 missense probably benign 0.33
IGL01694:Lama2 APN 10 27006742 missense possibly damaging 0.75
IGL01705:Lama2 APN 10 27189274 splice site probably benign
IGL01885:Lama2 APN 10 27105139 nonsense probably null
IGL01935:Lama2 APN 10 27422604 missense probably damaging 0.98
IGL01994:Lama2 APN 10 27467203 critical splice donor site probably null
IGL02041:Lama2 APN 10 26984326 missense probably damaging 1.00
IGL02067:Lama2 APN 10 27176796 missense probably benign 0.02
IGL02097:Lama2 APN 10 27138960 missense probably benign 0.09
IGL02179:Lama2 APN 10 27070364 missense probably benign 0.01
IGL02268:Lama2 APN 10 27001116 splice site probably benign
IGL02302:Lama2 APN 10 27212043 missense probably benign 0.06
IGL02363:Lama2 APN 10 27366066 missense probably damaging 1.00
IGL02378:Lama2 APN 10 27043656 missense probably damaging 0.99
IGL02642:Lama2 APN 10 27467273 missense probably damaging 1.00
IGL02676:Lama2 APN 10 27118493 missense probably benign 0.00
IGL02695:Lama2 APN 10 27000775 missense probably benign
IGL02735:Lama2 APN 10 27104128 missense probably damaging 1.00
IGL02794:Lama2 APN 10 27041231 missense possibly damaging 0.73
IGL02823:Lama2 APN 10 27001145 missense probably damaging 1.00
IGL02869:Lama2 APN 10 27015538 missense probably damaging 0.99
IGL02942:Lama2 APN 10 27041220 missense probably damaging 1.00
IGL03201:Lama2 APN 10 27344570 nonsense probably null
IGL03268:Lama2 APN 10 27422653 missense probably damaging 1.00
IGL03288:Lama2 APN 10 27369051 missense probably damaging 1.00
IGL03380:Lama2 APN 10 27050265 missense probably damaging 1.00
IGL03407:Lama2 APN 10 27347021 missense probably damaging 1.00
cowboy UTSW 10 27043643 frame shift probably null
petri UTSW 10 26993398 splice site probably null
PIT4362001:Lama2 UTSW 10 27369136 missense probably damaging 1.00
PIT4382001:Lama2 UTSW 10 27204905 missense probably damaging 1.00
PIT4431001:Lama2 UTSW 10 27101430 missense probably damaging 1.00
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0038:Lama2 UTSW 10 26986797 missense probably benign 0.02
R0114:Lama2 UTSW 10 26993068 nonsense probably null
R0142:Lama2 UTSW 10 27187845 missense probably benign
R0313:Lama2 UTSW 10 26993398 splice site probably null
R0376:Lama2 UTSW 10 27015546 missense possibly damaging 0.68
R0412:Lama2 UTSW 10 27190625 missense possibly damaging 0.58
R0472:Lama2 UTSW 10 26990867 missense probably damaging 1.00
R0607:Lama2 UTSW 10 27189131 missense probably benign 0.34
R0648:Lama2 UTSW 10 26989376 missense probably benign 0.00
R0667:Lama2 UTSW 10 27344410 splice site probably null
R0760:Lama2 UTSW 10 27044433 critical splice donor site probably null
R1240:Lama2 UTSW 10 27041124 missense probably damaging 1.00
R1385:Lama2 UTSW 10 27224043 missense probably benign 0.11
R1433:Lama2 UTSW 10 27187754 missense probably damaging 1.00
R1434:Lama2 UTSW 10 27208370 missense probably damaging 1.00
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1574:Lama2 UTSW 10 27324754 missense possibly damaging 0.65
R1645:Lama2 UTSW 10 27368985 missense probably damaging 1.00
R1702:Lama2 UTSW 10 27190529 missense probably benign
R1703:Lama2 UTSW 10 27266671 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208406 missense probably damaging 1.00
R1769:Lama2 UTSW 10 27208407 missense probably benign
R1846:Lama2 UTSW 10 27212096 missense probably damaging 1.00
R1859:Lama2 UTSW 10 27031082 missense possibly damaging 0.51
R1871:Lama2 UTSW 10 26984494 missense probably damaging 1.00
R1903:Lama2 UTSW 10 27188399 missense probably damaging 1.00
R1906:Lama2 UTSW 10 27056527 critical splice donor site probably null
R1958:Lama2 UTSW 10 26981598 missense probably damaging 0.97
R1959:Lama2 UTSW 10 27422618 missense probably damaging 1.00
R1977:Lama2 UTSW 10 26990800 splice site probably null
R2063:Lama2 UTSW 10 27164926 missense probably damaging 1.00
R2079:Lama2 UTSW 10 27369053 missense probably damaging 0.99
R2085:Lama2 UTSW 10 27204841 nonsense probably null
R2125:Lama2 UTSW 10 27044453 nonsense probably null
R2140:Lama2 UTSW 10 27054694 splice site probably null
R2219:Lama2 UTSW 10 27043569 missense probably damaging 0.99
R2259:Lama2 UTSW 10 27031127 missense probably benign 0.00
R2265:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2266:Lama2 UTSW 10 26986797 missense probably benign 0.02
R2267:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2268:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2269:Lama2 UTSW 10 26992936 missense probably damaging 1.00
R2862:Lama2 UTSW 10 27422612 nonsense probably null
R2912:Lama2 UTSW 10 27000803 missense probably benign
R2999:Lama2 UTSW 10 26989421 missense probably benign 0.18
R3034:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3081:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3107:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3109:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3436:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3437:Lama2 UTSW 10 27001235 missense probably benign 0.11
R3706:Lama2 UTSW 10 27138996 missense probably damaging 1.00
R3780:Lama2 UTSW 10 27459339 missense probably damaging 1.00
R3807:Lama2 UTSW 10 27190665 frame shift probably null
R3919:Lama2 UTSW 10 27118505 missense probably damaging 1.00
R4014:Lama2 UTSW 10 26984376 missense probably damaging 1.00
R4131:Lama2 UTSW 10 27041174 missense probably benign 0.00
R4190:Lama2 UTSW 10 27266664 missense probably damaging 0.96
R4273:Lama2 UTSW 10 27347054 missense probably damaging 1.00
R4358:Lama2 UTSW 10 26984493 missense probably damaging 1.00
R4407:Lama2 UTSW 10 27212128 small deletion probably benign
R4415:Lama2 UTSW 10 26989344 nonsense probably null
R4426:Lama2 UTSW 10 27422558 missense probably damaging 1.00
R4590:Lama2 UTSW 10 26989414 missense probably benign 0.00
R4615:Lama2 UTSW 10 26981524 missense probably damaging 0.99
R4736:Lama2 UTSW 10 27204929 missense probably damaging 1.00
R4754:Lama2 UTSW 10 27118531 missense possibly damaging 0.58
R4791:Lama2 UTSW 10 27467271 missense probably damaging 1.00
R4834:Lama2 UTSW 10 27006749 missense probably benign 0.30
R4856:Lama2 UTSW 10 27043643 frame shift probably null
R4858:Lama2 UTSW 10 27043643 frame shift probably null
R4859:Lama2 UTSW 10 27043643 frame shift probably null
R4897:Lama2 UTSW 10 27043643 frame shift probably null
R4899:Lama2 UTSW 10 27043643 frame shift probably null
R4907:Lama2 UTSW 10 27164946 missense probably benign 0.11
R4911:Lama2 UTSW 10 27138927 missense probably damaging 1.00
R4924:Lama2 UTSW 10 27369141 missense probably damaging 0.98
R5023:Lama2 UTSW 10 27190504 missense probably damaging 0.97
R5057:Lama2 UTSW 10 27164986 missense probably damaging 1.00
R5070:Lama2 UTSW 10 27350251 critical splice donor site probably null
R5116:Lama2 UTSW 10 27118560 missense probably benign 0.08
R5177:Lama2 UTSW 10 27190703 missense possibly damaging 0.94
R5198:Lama2 UTSW 10 27347003 missense probably damaging 0.96
R5289:Lama2 UTSW 10 27212073 nonsense probably null
R5327:Lama2 UTSW 10 27138946 missense probably benign
R5424:Lama2 UTSW 10 26984396 missense probably damaging 1.00
R5469:Lama2 UTSW 10 27041189 missense possibly damaging 0.92
R5620:Lama2 UTSW 10 26990880 missense probably damaging 0.99
R5667:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5671:Lama2 UTSW 10 27190544 missense probably damaging 1.00
R5815:Lama2 UTSW 10 26986851 missense probably damaging 1.00
R5917:Lama2 UTSW 10 27190697 missense probably damaging 1.00
R5935:Lama2 UTSW 10 27015498 missense probably benign
R5976:Lama2 UTSW 10 27190676 missense probably benign 0.00
R5979:Lama2 UTSW 10 27235732 missense probably damaging 0.99
R6004:Lama2 UTSW 10 27235785 missense probably benign 0.01
R6180:Lama2 UTSW 10 26981499 missense probably benign 0.03
R6198:Lama2 UTSW 10 27188022 missense probably damaging 1.00
R6257:Lama2 UTSW 10 26986899 missense possibly damaging 0.85
R6271:Lama2 UTSW 10 27023329 missense possibly damaging 0.67
R6322:Lama2 UTSW 10 27190547 missense probably damaging 0.96
R6354:Lama2 UTSW 10 27212068 missense probably damaging 1.00
R6431:Lama2 UTSW 10 27053031 missense possibly damaging 0.50
R6499:Lama2 UTSW 10 27031158 missense probably damaging 1.00
R6535:Lama2 UTSW 10 27104131 missense probably damaging 1.00
R6545:Lama2 UTSW 10 27176797 missense probably benign
R6636:Lama2 UTSW 10 27124568 missense probably benign 0.13
R6891:Lama2 UTSW 10 27328072 nonsense probably null
R6891:Lama2 UTSW 10 27328082 nonsense probably null
R6902:Lama2 UTSW 10 26981629 missense probably damaging 1.00
R6908:Lama2 UTSW 10 27031196 splice site probably null
R7168:Lama2 UTSW 10 27366152 critical splice acceptor site probably null
R7233:Lama2 UTSW 10 27231663 missense probably damaging 1.00
R7272:Lama2 UTSW 10 27124556 missense probably damaging 1.00
R7274:Lama2 UTSW 10 27119980 missense probably damaging 0.99
R7419:Lama2 UTSW 10 27266634 missense probably benign
R7423:Lama2 UTSW 10 27212226 missense probably benign 0.00
R7554:Lama2 UTSW 10 27155496 missense probably damaging 1.00
R7569:Lama2 UTSW 10 27265050 missense probably damaging 1.00
R7574:Lama2 UTSW 10 27006730 missense probably benign 0.03
R7584:Lama2 UTSW 10 27104261 missense possibly damaging 0.78
R7586:Lama2 UTSW 10 27101393 missense probably benign 0.00
R7603:Lama2 UTSW 10 27266680 missense possibly damaging 0.55
R7691:Lama2 UTSW 10 27208393 missense possibly damaging 0.67
R7750:Lama2 UTSW 10 26990924 missense probably damaging 0.97
R7841:Lama2 UTSW 10 27155533 missense probably benign 0.00
R7864:Lama2 UTSW 10 27056615 missense probably benign 0.08
R7924:Lama2 UTSW 10 27155533 missense probably benign 0.00
R7947:Lama2 UTSW 10 27056615 missense probably benign 0.08
R8013:Lama2 UTSW 10 27344498 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGCACACATGGACATGCATATG -3'
(R):5'- TACCACAGATTCCTCCGATATAAG -3'

Sequencing Primer
(F):5'- GCATATGCAGCTACATTGATGAAATG -3'
(R):5'- CACAGATTCCTCCGATATAAGATGTG -3'
Posted On2016-03-17