Incidental Mutation 'R4898:Ttc41'
ID 375933
Institutional Source Beutler Lab
Gene Symbol Ttc41
Ensembl Gene ENSMUSG00000044937
Gene Name tetratricopeptide repeat domain 41
Synonyms BC030307, Gnn
MMRRC Submission 042502-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.126) question?
Stock # R4898 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 86541675-86612708 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86612056 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 1110 (S1110P)
Ref Sequence ENSEMBL: ENSMUSP00000075059 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075632] [ENSMUST00000099396]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000075632
AA Change: S1110P

PolyPhen 2 Score 0.799 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000075059
Gene: ENSMUSG00000044937
AA Change: S1110P

DomainStartEndE-ValueType
low complexity region 216 229 N/A INTRINSIC
low complexity region 307 315 N/A INTRINSIC
Pfam:NACHT 337 515 5.4e-10 PFAM
SCOP:d1qqea_ 805 1028 2e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000099396
SMART Domains Protein: ENSMUSP00000096994
Gene: ENSMUSG00000054027

DomainStartEndE-ValueType
low complexity region 5 25 N/A INTRINSIC
Pfam:5_nucleotid 83 526 1.8e-159 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218802
Predicted Effect probably benign
Transcript: ENSMUST00000219476
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,639,111 (GRCm39) Y944C probably damaging Het
Acacb T C 5: 114,370,999 (GRCm39) V1747A probably benign Het
Acad8 C T 9: 26,889,698 (GRCm39) R332H probably damaging Het
Acrbp A C 6: 125,027,501 (GRCm39) T50P probably damaging Het
Ahctf1 G T 1: 179,583,077 (GRCm39) N1500K probably benign Het
Aoc1l3 A G 6: 48,964,651 (GRCm39) T220A possibly damaging Het
Arfgef1 A G 1: 10,229,798 (GRCm39) I1301T possibly damaging Het
Arhgef15 T C 11: 68,842,171 (GRCm39) S478G probably benign Het
Armh1 T C 4: 117,094,977 (GRCm39) D21G probably damaging Het
Atp13a4 A T 16: 29,227,779 (GRCm39) L1045* probably null Het
Atp2a3 T A 11: 72,873,506 (GRCm39) L793H probably damaging Het
B4galnt4 C A 7: 140,648,173 (GRCm39) P563Q probably benign Het
Bcl2a1b A T 9: 89,081,713 (GRCm39) K94* probably null Het
Bod1 T A 11: 31,616,853 (GRCm39) Q136L possibly damaging Het
C2cd3 A G 7: 100,055,166 (GRCm39) K443R probably damaging Het
Cadps A G 14: 12,411,588 (GRCm38) V1250A possibly damaging Het
Car12 T A 9: 66,671,600 (GRCm39) Y332* probably null Het
Ccdc186 A T 19: 56,790,432 (GRCm39) probably null Het
Cdh6 T C 15: 13,034,774 (GRCm39) T629A probably damaging Het
Cep112 T A 11: 108,397,471 (GRCm39) D353E probably damaging Het
Cep152 T C 2: 125,428,301 (GRCm39) S777G probably benign Het
Clec4b2 A C 6: 123,181,163 (GRCm39) K183Q probably benign Het
Cngb3 T C 4: 19,395,926 (GRCm39) Y323H probably benign Het
Cnp G T 11: 100,467,202 (GRCm39) E48D probably benign Het
Ctrb1 T A 8: 112,413,783 (GRCm39) I194F probably benign Het
Cyp2d11 T A 15: 82,275,224 (GRCm39) D241V probably benign Het
D5Ertd579e T A 5: 36,772,285 (GRCm39) E703D probably damaging Het
Dlg1 T C 16: 31,676,764 (GRCm39) V731A probably damaging Het
Dlgap5 T C 14: 47,651,276 (GRCm39) S86G probably benign Het
Dock3 A G 9: 106,807,266 (GRCm39) F1354L probably damaging Het
Dock3 C A 9: 106,870,171 (GRCm39) V638F possibly damaging Het
Eif3c A T 7: 126,156,626 (GRCm39) M407K probably benign Het
Eif4a3l1 A T 6: 136,305,737 (GRCm39) Q66L possibly damaging Het
Epha4 T A 1: 77,366,712 (GRCm39) K578* probably null Het
Erc2 C T 14: 27,375,285 (GRCm39) L168F probably damaging Het
Esyt2 A G 12: 116,305,708 (GRCm39) I313V probably benign Het
Far1 T A 7: 113,167,432 (GRCm39) Y506N probably damaging Het
Fbxw26 T A 9: 109,547,037 (GRCm39) N463Y possibly damaging Het
Fgg A G 3: 82,915,847 (GRCm39) D96G probably benign Het
Gfer A G 17: 24,914,274 (GRCm39) S130P probably damaging Het
Hdac10 A T 15: 89,012,650 (GRCm39) M1K probably null Het
Hsd3b1 A T 3: 98,760,642 (GRCm39) S110R probably benign Het
Ints15 A G 5: 143,287,592 (GRCm39) S438P probably benign Het
Itga6 T C 2: 71,668,717 (GRCm39) L552P possibly damaging Het
Klk14 G A 7: 43,341,501 (GRCm39) C51Y probably damaging Het
Lama2 TTTGCGCATT TTT 10: 26,919,639 (GRCm39) probably null Het
Llgl1 C T 11: 60,600,394 (GRCm39) P581L probably benign Het
Lrrc8a A G 2: 30,147,214 (GRCm39) K676R probably benign Het
Lrrc8b A T 5: 105,628,080 (GRCm39) Y142F probably benign Het
Lyz2 T A 10: 117,114,614 (GRCm39) D105V possibly damaging Het
Mamdc4 T C 2: 25,460,035 (GRCm39) D76G probably damaging Het
Map7d1 T C 4: 126,127,018 (GRCm39) K731E unknown Het
Mgam A C 6: 40,619,988 (GRCm39) I26L probably benign Het
Mmp13 A T 9: 7,272,953 (GRCm39) E104D probably benign Het
Morc2a C T 11: 3,626,664 (GRCm39) R241* probably null Het
Mtfmt C A 9: 65,359,386 (GRCm39) H354N probably benign Het
Myh3 T C 11: 66,990,233 (GRCm39) I1626T probably benign Het
Ndst1 A T 18: 60,825,059 (GRCm39) V753D probably benign Het
Neurl4 A G 11: 69,793,997 (GRCm39) D151G probably damaging Het
Nlrx1 T C 9: 44,168,194 (GRCm39) S568G probably benign Het
Or10g3b G C 14: 52,586,999 (GRCm39) P168R probably damaging Het
Or2t45 T C 11: 58,669,132 (GRCm39) Y60H possibly damaging Het
Or2t46 T G 11: 58,472,546 (GRCm39) L292R probably damaging Het
Or4c52 T C 2: 89,845,762 (GRCm39) F163L probably damaging Het
Or52s1 A G 7: 102,861,747 (GRCm39) I216V probably damaging Het
Or6c66 A T 10: 129,461,468 (GRCm39) I154N probably benign Het
Or8b42 A T 9: 38,342,111 (GRCm39) M178L probably benign Het
Osbpl7 A G 11: 96,950,976 (GRCm39) I608V probably damaging Het
Pard3b T C 1: 61,807,159 (GRCm39) I58T probably damaging Het
Pcare A G 17: 72,058,066 (GRCm39) M537T probably damaging Het
Pcdhga1 A C 18: 37,795,407 (GRCm39) E137A possibly damaging Het
Pde6c G A 19: 38,139,072 (GRCm39) V301I possibly damaging Het
Pdia5 G C 16: 35,230,786 (GRCm39) N338K possibly damaging Het
Pex11g T C 8: 3,514,042 (GRCm39) Y40C probably damaging Het
Plekhg3 A G 12: 76,610,899 (GRCm39) Y183C probably damaging Het
Pole A C 5: 110,438,090 (GRCm39) probably null Het
Ppfia1 A G 7: 144,045,313 (GRCm39) L948P probably damaging Het
Prdm2 A T 4: 142,860,761 (GRCm39) V843E probably damaging Het
Prss56 C A 1: 87,115,708 (GRCm39) F527L probably damaging Het
Psmd11 T C 11: 80,329,146 (GRCm39) L88P probably damaging Het
Ptx3 G C 3: 66,132,412 (GRCm39) G311A probably damaging Het
Rars1 A T 11: 35,699,385 (GRCm39) L636H probably damaging Het
Rnft2 A G 5: 118,375,507 (GRCm39) S81P probably benign Het
Rufy4 T C 1: 74,186,822 (GRCm39) C537R probably damaging Het
Rxra T A 2: 27,631,195 (GRCm39) I142N probably damaging Het
Scin T C 12: 40,154,931 (GRCm39) M221V probably benign Het
Sfmbt2 G A 2: 10,584,069 (GRCm39) V809I possibly damaging Het
Sirt1 T A 10: 63,157,783 (GRCm39) I505F probably benign Het
Six5 T C 7: 18,829,096 (GRCm39) Y179H probably damaging Het
Slc12a4 A C 8: 106,671,241 (GRCm39) M982R probably damaging Het
Slco4c1 T A 1: 96,765,237 (GRCm39) L404F probably damaging Het
Smn1 T C 13: 100,268,931 (GRCm39) L259P probably damaging Het
Sorl1 T G 9: 41,952,935 (GRCm39) D702A probably damaging Het
Spta1 A G 1: 174,065,400 (GRCm39) E1983G possibly damaging Het
Srsf1 T A 11: 87,940,788 (GRCm39) probably null Het
Stard9 C T 2: 120,536,900 (GRCm39) R4224* probably null Het
Sybu T G 15: 44,538,895 (GRCm39) M383L probably benign Het
Tbx15 A C 3: 99,259,583 (GRCm39) N485H possibly damaging Het
Tcerg1l A T 7: 137,819,786 (GRCm39) F485I probably damaging Het
Tdrd7 C A 4: 46,005,616 (GRCm39) T474N possibly damaging Het
Thada A T 17: 84,755,470 (GRCm39) probably null Het
Tnik A T 3: 28,704,235 (GRCm39) I1020F probably damaging Het
Tnxb A G 17: 34,914,566 (GRCm39) D1884G possibly damaging Het
Tprn T C 2: 25,158,845 (GRCm39) M623T probably damaging Het
Trdn T A 10: 33,350,413 (GRCm39) Y661N probably damaging Het
Ttc6 A C 12: 57,707,026 (GRCm39) R644S probably benign Het
Ttyh1 A T 7: 4,136,735 (GRCm39) M448L probably benign Het
Unc79 G T 12: 103,128,079 (GRCm39) C2250F probably damaging Het
Ush2a A G 1: 188,358,805 (GRCm39) I2110M probably benign Het
Uvssa G T 5: 33,571,257 (GRCm39) E634* probably null Het
Vac14 A C 8: 111,372,440 (GRCm39) T384P probably benign Het
Wdr11 A G 7: 129,235,445 (GRCm39) E1169G probably benign Het
Zfp36l1 T A 12: 80,157,298 (GRCm39) T28S probably benign Het
Zfp715 A T 7: 42,949,106 (GRCm39) Y285N possibly damaging Het
Zfp91 A T 19: 12,747,424 (GRCm39) D566E probably damaging Het
Zgrf1 G A 3: 127,396,085 (GRCm39) V544M probably damaging Het
Other mutations in Ttc41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00846:Ttc41 APN 10 86,572,797 (GRCm39) missense possibly damaging 0.71
IGL01373:Ttc41 APN 10 86,611,821 (GRCm39) missense possibly damaging 0.61
IGL01636:Ttc41 APN 10 86,612,542 (GRCm39) missense probably benign
IGL01707:Ttc41 APN 10 86,612,631 (GRCm39) missense probably damaging 1.00
IGL01814:Ttc41 APN 10 86,566,890 (GRCm39) missense probably damaging 0.98
IGL01845:Ttc41 APN 10 86,612,488 (GRCm39) missense probably benign 0.03
IGL01918:Ttc41 APN 10 86,549,054 (GRCm39) missense probably damaging 1.00
IGL02374:Ttc41 APN 10 86,611,815 (GRCm39) missense probably damaging 1.00
IGL02489:Ttc41 APN 10 86,596,778 (GRCm39) nonsense probably null
IGL02887:Ttc41 APN 10 86,569,518 (GRCm39) missense probably damaging 1.00
IGL03061:Ttc41 APN 10 86,572,721 (GRCm39) missense possibly damaging 0.65
IGL03077:Ttc41 APN 10 86,594,212 (GRCm39) missense probably damaging 1.00
IGL03210:Ttc41 APN 10 86,560,278 (GRCm39) critical splice donor site probably null
IGL03242:Ttc41 APN 10 86,612,683 (GRCm39) makesense probably null
IGL03307:Ttc41 APN 10 86,580,304 (GRCm39) missense possibly damaging 0.76
BB003:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
BB013:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0071:Ttc41 UTSW 10 86,572,710 (GRCm39) missense probably benign 0.01
R0379:Ttc41 UTSW 10 86,548,841 (GRCm39) missense possibly damaging 0.65
R0384:Ttc41 UTSW 10 86,599,811 (GRCm39) missense probably damaging 1.00
R0545:Ttc41 UTSW 10 86,594,961 (GRCm39) missense probably benign 0.00
R1589:Ttc41 UTSW 10 86,612,254 (GRCm39) missense probably benign 0.01
R1599:Ttc41 UTSW 10 86,612,437 (GRCm39) missense probably benign 0.04
R1608:Ttc41 UTSW 10 86,611,857 (GRCm39) missense probably damaging 1.00
R1670:Ttc41 UTSW 10 86,612,116 (GRCm39) missense possibly damaging 0.93
R1938:Ttc41 UTSW 10 86,612,078 (GRCm39) missense probably benign
R2398:Ttc41 UTSW 10 86,549,250 (GRCm39) missense possibly damaging 0.91
R2401:Ttc41 UTSW 10 86,560,238 (GRCm39) missense probably benign 0.42
R3117:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R3119:Ttc41 UTSW 10 86,560,184 (GRCm39) missense possibly damaging 0.62
R4805:Ttc41 UTSW 10 86,565,662 (GRCm39) missense possibly damaging 0.62
R4840:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4841:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4842:Ttc41 UTSW 10 86,566,989 (GRCm39) missense probably benign 0.10
R4884:Ttc41 UTSW 10 86,566,882 (GRCm39) missense probably benign 0.00
R4885:Ttc41 UTSW 10 86,594,966 (GRCm39) missense possibly damaging 0.76
R5067:Ttc41 UTSW 10 86,580,408 (GRCm39) missense probably damaging 0.96
R5253:Ttc41 UTSW 10 86,566,806 (GRCm39) missense probably benign 0.13
R5268:Ttc41 UTSW 10 86,580,342 (GRCm39) missense possibly damaging 0.76
R5297:Ttc41 UTSW 10 86,612,443 (GRCm39) missense probably benign 0.04
R5301:Ttc41 UTSW 10 86,555,384 (GRCm39) missense probably benign 0.00
R5425:Ttc41 UTSW 10 86,612,494 (GRCm39) missense probably damaging 0.96
R5567:Ttc41 UTSW 10 86,596,784 (GRCm39) critical splice donor site probably null
R5635:Ttc41 UTSW 10 86,572,841 (GRCm39) missense probably benign 0.09
R5752:Ttc41 UTSW 10 86,594,210 (GRCm39) missense probably benign 0.33
R5868:Ttc41 UTSW 10 86,586,128 (GRCm39) missense possibly damaging 0.70
R5948:Ttc41 UTSW 10 86,549,088 (GRCm39) missense probably damaging 1.00
R6116:Ttc41 UTSW 10 86,594,952 (GRCm39) critical splice acceptor site probably null
R6247:Ttc41 UTSW 10 86,612,527 (GRCm39) missense probably benign 0.00
R6260:Ttc41 UTSW 10 86,569,571 (GRCm39) missense probably benign 0.32
R6260:Ttc41 UTSW 10 86,567,023 (GRCm39) missense probably benign 0.20
R6276:Ttc41 UTSW 10 86,580,313 (GRCm39) missense probably benign 0.01
R6458:Ttc41 UTSW 10 86,594,134 (GRCm39) missense possibly damaging 0.45
R7170:Ttc41 UTSW 10 86,549,367 (GRCm39) missense probably benign 0.17
R7348:Ttc41 UTSW 10 86,586,212 (GRCm39) nonsense probably null
R7382:Ttc41 UTSW 10 86,612,374 (GRCm39) missense probably damaging 0.97
R7509:Ttc41 UTSW 10 86,549,296 (GRCm39) missense probably damaging 1.00
R7689:Ttc41 UTSW 10 86,595,088 (GRCm39) missense probably damaging 1.00
R7807:Ttc41 UTSW 10 86,612,495 (GRCm39) missense probably benign 0.02
R7926:Ttc41 UTSW 10 86,611,911 (GRCm39) missense probably benign 0.10
R7998:Ttc41 UTSW 10 86,572,711 (GRCm39) missense probably benign 0.01
R8021:Ttc41 UTSW 10 86,569,578 (GRCm39) missense probably benign
R8059:Ttc41 UTSW 10 86,548,842 (GRCm39) missense probably benign 0.01
R8170:Ttc41 UTSW 10 86,612,030 (GRCm39) missense probably damaging 1.00
R8303:Ttc41 UTSW 10 86,555,494 (GRCm39) missense probably benign 0.06
R8375:Ttc41 UTSW 10 86,599,844 (GRCm39) missense probably damaging 0.97
R8383:Ttc41 UTSW 10 86,555,390 (GRCm39) missense probably benign 0.00
R8698:Ttc41 UTSW 10 86,548,841 (GRCm39) missense probably benign 0.00
R8773:Ttc41 UTSW 10 86,565,679 (GRCm39) missense probably benign 0.35
R8902:Ttc41 UTSW 10 86,548,865 (GRCm39) missense probably benign 0.06
R8985:Ttc41 UTSW 10 86,566,956 (GRCm39) missense possibly damaging 0.80
R8988:Ttc41 UTSW 10 86,549,599 (GRCm39) missense possibly damaging 0.88
R9007:Ttc41 UTSW 10 86,569,625 (GRCm39) missense probably damaging 1.00
R9137:Ttc41 UTSW 10 86,612,486 (GRCm39) missense probably benign 0.22
R9236:Ttc41 UTSW 10 86,612,594 (GRCm39) missense probably damaging 1.00
R9248:Ttc41 UTSW 10 86,567,113 (GRCm39) missense probably benign 0.00
R9287:Ttc41 UTSW 10 86,599,830 (GRCm39) missense probably benign 0.43
R9345:Ttc41 UTSW 10 86,595,089 (GRCm39) missense probably damaging 0.99
R9386:Ttc41 UTSW 10 86,548,890 (GRCm39) missense probably damaging 0.99
R9500:Ttc41 UTSW 10 86,565,726 (GRCm39) missense probably benign 0.03
R9570:Ttc41 UTSW 10 86,549,598 (GRCm39) missense possibly damaging 0.88
R9593:Ttc41 UTSW 10 86,549,049 (GRCm39) missense probably benign 0.24
X0024:Ttc41 UTSW 10 86,560,114 (GRCm39) missense probably damaging 1.00
X0064:Ttc41 UTSW 10 86,565,661 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CCATCATGCCACAATGGAGG -3'
(R):5'- GAAGGCTGTGTGCTTTTAACTC -3'

Sequencing Primer
(F):5'- TGATTTAAGGGCAGCTCACC -3'
(R):5'- GTGCTTTTAACTCTCTGAAACCTACG -3'
Posted On 2016-03-17