Incidental Mutation 'R4898:Unc79'
ID375954
Institutional Source Beutler Lab
Gene Symbol Unc79
Ensembl Gene ENSMUSG00000021198
Gene Nameunc-79 homolog (C. elegans)
Synonyms9030205A07Rik, Mlca3
MMRRC Submission 042502-MU
Accession Numbers

Genbank: NM_001081017; MGI: 2684729; Ensembl: ENSMUST00000085079

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4898 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location102948859-103184065 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 103161820 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Phenylalanine at position 2250 (C2250F)
Ref Sequence ENSEMBL: ENSMUSP00000098659 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085079] [ENSMUST00000101099] [ENSMUST00000178076] [ENSMUST00000179002]
Predicted Effect possibly damaging
Transcript: ENSMUST00000085079
AA Change: C2112F

PolyPhen 2 Score 0.752 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000082156
Gene: ENSMUSG00000021198
AA Change: C2112F

DomainStartEndE-ValueType
Pfam:UNC-79 1 469 3.1e-223 PFAM
low complexity region 732 737 N/A INTRINSIC
low complexity region 846 862 N/A INTRINSIC
low complexity region 968 977 N/A INTRINSIC
low complexity region 1114 1125 N/A INTRINSIC
low complexity region 1313 1325 N/A INTRINSIC
low complexity region 1428 1440 N/A INTRINSIC
low complexity region 1471 1476 N/A INTRINSIC
low complexity region 1477 1489 N/A INTRINSIC
low complexity region 1490 1504 N/A INTRINSIC
low complexity region 1541 1556 N/A INTRINSIC
low complexity region 1861 1870 N/A INTRINSIC
low complexity region 2237 2246 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000101099
AA Change: C2250F

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000098659
Gene: ENSMUSG00000021198
AA Change: C2250F

DomainStartEndE-ValueType
Pfam:UNC-79 113 646 1.2e-226 PFAM
low complexity region 909 914 N/A INTRINSIC
low complexity region 1023 1039 N/A INTRINSIC
low complexity region 1145 1154 N/A INTRINSIC
low complexity region 1291 1302 N/A INTRINSIC
low complexity region 1490 1502 N/A INTRINSIC
low complexity region 1605 1617 N/A INTRINSIC
low complexity region 1648 1653 N/A INTRINSIC
low complexity region 1654 1666 N/A INTRINSIC
low complexity region 1667 1681 N/A INTRINSIC
low complexity region 1718 1733 N/A INTRINSIC
low complexity region 1999 2008 N/A INTRINSIC
low complexity region 2375 2384 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178076
AA Change: C2115F

PolyPhen 2 Score 0.172 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136888
Gene: ENSMUSG00000021198
AA Change: C2115F

DomainStartEndE-ValueType
Pfam:UNC-79 1 450 4.2e-213 PFAM
low complexity region 713 718 N/A INTRINSIC
low complexity region 827 843 N/A INTRINSIC
low complexity region 949 958 N/A INTRINSIC
low complexity region 1117 1128 N/A INTRINSIC
low complexity region 1316 1328 N/A INTRINSIC
low complexity region 1431 1443 N/A INTRINSIC
low complexity region 1474 1479 N/A INTRINSIC
low complexity region 1480 1492 N/A INTRINSIC
low complexity region 1493 1507 N/A INTRINSIC
low complexity region 1544 1559 N/A INTRINSIC
low complexity region 1864 1873 N/A INTRINSIC
low complexity region 2240 2249 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179002
AA Change: C2308F

PolyPhen 2 Score 0.163 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000136332
Gene: ENSMUSG00000021198
AA Change: C2308F

DomainStartEndE-ValueType
Pfam:UNC-79 60 593 1.3e-226 PFAM
low complexity region 856 861 N/A INTRINSIC
low complexity region 970 986 N/A INTRINSIC
low complexity region 1092 1101 N/A INTRINSIC
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1509 1521 N/A INTRINSIC
low complexity region 1624 1636 N/A INTRINSIC
low complexity region 1667 1672 N/A INTRINSIC
low complexity region 1673 1685 N/A INTRINSIC
low complexity region 1686 1700 N/A INTRINSIC
low complexity region 1737 1752 N/A INTRINSIC
low complexity region 2057 2066 N/A INTRINSIC
low complexity region 2433 2442 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.8%
  • 20x: 93.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The NALCN channel is responsible for Na(+) leak currents. The protein encoded by this gene, along with UNC80, is an accessory subunit of the NALCN channel that contributes to the Ca(2+) sensitivity of the channel. [provided by RefSeq, Sep 2016]
PHENOTYPE: Homozygous mutation results in lethality within the first week after birth, mostly at P0 or P1. Pups fail to nurse and have no milk in stomachs resulting in weakness, inactivity and no weight gain. [provided by MGI curators]
Allele List at MGI

 All alleles(2) : Targeted, knock-out(1) Chemically induced(1)

Other mutations in this stock
Total: 116 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc6 T C 7: 45,989,687 Y944C probably damaging Het
Acacb T C 5: 114,232,938 V1747A probably benign Het
Acad8 C T 9: 26,978,402 R332H probably damaging Het
Acrbp A C 6: 125,050,538 T50P probably damaging Het
Ahctf1 G T 1: 179,755,512 N1500K probably benign Het
Arfgef1 A G 1: 10,159,573 I1301T possibly damaging Het
Arhgef15 T C 11: 68,951,345 S478G probably benign Het
Armh1 T C 4: 117,237,780 D21G probably damaging Het
Atp13a4 A T 16: 29,408,961 L1045* probably null Het
Atp2a3 T A 11: 72,982,680 L793H probably damaging Het
B4galnt4 C A 7: 141,068,260 P563Q probably benign Het
BC027072 A G 17: 71,751,071 M537T probably damaging Het
Bcl2a1b A T 9: 89,199,660 K94* probably null Het
Bod1 T A 11: 31,666,853 Q136L possibly damaging Het
C2cd3 A G 7: 100,405,959 K443R probably damaging Het
Cadps A G 14: 12,411,588 V1250A possibly damaging Het
Car12 T A 9: 66,764,318 Y332* probably null Het
Ccdc186 A T 19: 56,802,000 probably null Het
Cdh6 T C 15: 13,034,688 T629A probably damaging Het
Cep112 T A 11: 108,506,645 D353E probably damaging Het
Cep152 T C 2: 125,586,381 S777G probably benign Het
Clec4b2 A C 6: 123,204,204 K183Q probably benign Het
Cngb3 T C 4: 19,395,926 Y323H probably benign Het
Cnp G T 11: 100,576,376 E48D probably benign Het
Ctrb1 T A 8: 111,687,151 I194F probably benign Het
Cyp2d11 T A 15: 82,391,023 D241V probably benign Het
D5Ertd579e T A 5: 36,614,941 E703D probably damaging Het
Dlg1 T C 16: 31,857,946 V731A probably damaging Het
Dlgap5 T C 14: 47,413,819 S86G probably benign Het
Dock3 A G 9: 106,930,067 F1354L probably damaging Het
Dock3 C A 9: 106,992,972 V638F possibly damaging Het
E130309D02Rik A G 5: 143,301,837 S438P probably benign Het
Eif3c A T 7: 126,557,454 M407K probably benign Het
Epha4 T A 1: 77,390,075 K578* probably null Het
Erc2 C T 14: 27,653,328 L168F probably damaging Het
Esyt2 A G 12: 116,342,088 I313V probably benign Het
Far1 T A 7: 113,568,225 Y506N probably damaging Het
Fbxw26 T A 9: 109,717,969 N463Y possibly damaging Het
Fgg A G 3: 83,008,540 D96G probably benign Het
Gfer A G 17: 24,695,300 S130P probably damaging Het
Gm8994 A T 6: 136,328,739 Q66L possibly damaging Het
Hdac10 A T 15: 89,128,447 M1K probably null Het
Hsd3b1 A T 3: 98,853,326 S110R probably benign Het
Itga6 T C 2: 71,838,373 L552P possibly damaging Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Lrrc8a A G 2: 30,257,202 K676R probably benign Het
Lrrc8b A T 5: 105,480,214 Y142F probably benign Het
Lyz2 T A 10: 117,278,709 D105V possibly damaging Het
Mamdc4 T C 2: 25,570,023 D76G probably damaging Het
Map7d1 T C 4: 126,233,225 K731E unknown Het
Mgam A C 6: 40,643,054 I26L probably benign Het
Mmp13 A T 9: 7,272,953 E104D probably benign Het
Morc2a C T 11: 3,676,664 R241* probably null Het
Mtfmt C A 9: 65,452,104 H354N probably benign Het
Myh3 T C 11: 67,099,407 I1626T probably benign Het
Ndst1 A T 18: 60,691,987 V753D probably benign Het
Neurl4 A G 11: 69,903,171 D151G probably damaging Het
Nlrx1 T C 9: 44,256,897 S568G probably benign Het
Olfr1263 T C 2: 90,015,418 F163L probably damaging Het
Olfr1513 G C 14: 52,349,542 P168R probably damaging Het
Olfr315 T C 11: 58,778,306 Y60H possibly damaging Het
Olfr325 T G 11: 58,581,720 L292R probably damaging Het
Olfr593 A G 7: 103,212,540 I216V probably damaging Het
Olfr798 A T 10: 129,625,599 I154N probably benign Het
Olfr901 A T 9: 38,430,815 M178L probably benign Het
Osbpl7 A G 11: 97,060,150 I608V probably damaging Het
Pard3b T C 1: 61,768,000 I58T probably damaging Het
Pcdhga1 A C 18: 37,662,354 E137A possibly damaging Het
Pde6c G A 19: 38,150,624 V301I possibly damaging Het
Pdia5 G C 16: 35,410,416 N338K possibly damaging Het
Pex11g T C 8: 3,464,042 Y40C probably damaging Het
Plekhg3 A G 12: 76,564,125 Y183C probably damaging Het
Pole A C 5: 110,290,224 probably null Het
Ppfia1 A G 7: 144,491,576 L948P probably damaging Het
Prdm2 A T 4: 143,134,191 V843E probably damaging Het
Prss56 C A 1: 87,187,986 F527L probably damaging Het
Psmd11 T C 11: 80,438,320 L88P probably damaging Het
Ptx3 G C 3: 66,224,991 G311A probably damaging Het
Rars A T 11: 35,808,558 L636H probably damaging Het
Rnft2 A G 5: 118,237,442 S81P probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxra T A 2: 27,741,183 I142N probably damaging Het
Scin T C 12: 40,104,932 M221V probably benign Het
Sfmbt2 G A 2: 10,579,258 V809I possibly damaging Het
Sirt1 T A 10: 63,322,004 I505F probably benign Het
Six5 T C 7: 19,095,171 Y179H probably damaging Het
Slc12a4 A C 8: 105,944,609 M982R probably damaging Het
Slco4c1 T A 1: 96,837,512 L404F probably damaging Het
Smn1 T C 13: 100,132,423 L259P probably damaging Het
Sorl1 T G 9: 42,041,639 D702A probably damaging Het
Spta1 A G 1: 174,237,834 E1983G possibly damaging Het
Srsf1 T A 11: 88,049,962 probably null Het
Stard9 C T 2: 120,706,419 R4224* probably null Het
Svs1 A G 6: 48,987,717 T220A possibly damaging Het
Sybu T G 15: 44,675,499 M383L probably benign Het
Tbx15 A C 3: 99,352,267 N485H possibly damaging Het
Tcerg1l A T 7: 138,218,057 F485I probably damaging Het
Tdrd7 C A 4: 46,005,616 T474N possibly damaging Het
Thada A T 17: 84,448,042 probably null Het
Tnik A T 3: 28,650,086 I1020F probably damaging Het
Tnxb A G 17: 34,695,592 D1884G possibly damaging Het
Tprn T C 2: 25,268,833 M623T probably damaging Het
Trdn T A 10: 33,474,417 Y661N probably damaging Het
Ttc41 T C 10: 86,776,192 S1110P possibly damaging Het
Ttc6 A C 12: 57,660,240 R644S probably benign Het
Ttyh1 A T 7: 4,133,736 M448L probably benign Het
Ush2a A G 1: 188,626,608 I2110M probably benign Het
Uvssa G T 5: 33,413,913 E634* probably null Het
Vac14 A C 8: 110,645,808 T384P probably benign Het
Wdr11 A G 7: 129,633,721 E1169G probably benign Het
Zfp36l1 T A 12: 80,110,524 T28S probably benign Het
Zfp715 A T 7: 43,299,682 Y285N possibly damaging Het
Zfp91 A T 19: 12,770,060 D566E probably damaging Het
Zgrf1 G A 3: 127,602,436 V544M probably damaging Het
Other mutations in Unc79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00718:Unc79 APN 12 103169647 missense possibly damaging 0.68
IGL00835:Unc79 APN 12 103141890 splice site probably benign
IGL00917:Unc79 APN 12 103088507 missense possibly damaging 0.53
IGL01012:Unc79 APN 12 103112455 missense probably damaging 1.00
IGL01121:Unc79 APN 12 103165631 missense probably damaging 0.99
IGL01303:Unc79 APN 12 103161867 missense possibly damaging 0.94
IGL01305:Unc79 APN 12 103001871 missense probably damaging 0.99
IGL01315:Unc79 APN 12 103088521 missense possibly damaging 0.66
IGL01388:Unc79 APN 12 103169759 splice site probably benign
IGL01415:Unc79 APN 12 103108685 missense probably damaging 1.00
IGL01447:Unc79 APN 12 103078918 missense probably damaging 1.00
IGL01655:Unc79 APN 12 103168287 missense probably benign 0.00
IGL01662:Unc79 APN 12 103149020 missense possibly damaging 0.92
IGL01728:Unc79 APN 12 103165684 missense probably damaging 0.98
IGL01767:Unc79 APN 12 103141997 missense probably damaging 1.00
IGL02080:Unc79 APN 12 103001975 missense probably damaging 1.00
IGL02115:Unc79 APN 12 102998674 missense probably damaging 1.00
IGL02176:Unc79 APN 12 102998747 splice site probably null
IGL02186:Unc79 APN 12 103011283 missense probably benign 0.04
IGL02205:Unc79 APN 12 103079001 missense probably damaging 1.00
IGL02337:Unc79 APN 12 103156446 splice site probably benign
IGL02498:Unc79 APN 12 103171578 missense probably damaging 0.99
IGL02508:Unc79 APN 12 103112276 missense probably damaging 0.97
IGL02508:Unc79 APN 12 103112018 splice site probably benign
IGL02557:Unc79 APN 12 103182159 splice site probably benign
IGL02589:Unc79 APN 12 103173496 missense probably damaging 1.00
IGL02611:Unc79 APN 12 103165708 missense probably damaging 0.97
IGL02728:Unc79 APN 12 103122429 missense possibly damaging 0.53
IGL02827:Unc79 APN 12 103074846 missense possibly damaging 0.88
IGL03028:Unc79 APN 12 103173526 missense possibly damaging 0.83
IGL03144:Unc79 APN 12 103042142 missense probably damaging 1.00
IGL03229:Unc79 APN 12 103134539 missense probably damaging 0.99
IGL03269:Unc79 APN 12 103088677 missense probably damaging 1.00
IGL03325:Unc79 APN 12 103169610 missense probably damaging 0.98
pencil-thin UTSW 12 103108781 splice site probably null
sweetpea UTSW 12 103059518 missense probably damaging 1.00
3-1:Unc79 UTSW 12 103072750 nonsense probably null
ANU22:Unc79 UTSW 12 103001871 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0046:Unc79 UTSW 12 103125681 missense probably damaging 0.99
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0067:Unc79 UTSW 12 103059518 missense probably damaging 1.00
R0107:Unc79 UTSW 12 103134525 missense possibly damaging 0.70
R0110:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0128:Unc79 UTSW 12 103088434 splice site probably benign
R0166:Unc79 UTSW 12 103156553 missense probably damaging 1.00
R0208:Unc79 UTSW 12 103092027 missense probably benign 0.00
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0211:Unc79 UTSW 12 103072792 missense probably benign 0.01
R0218:Unc79 UTSW 12 103108781 splice site probably null
R0244:Unc79 UTSW 12 103112891 missense probably damaging 1.00
R0305:Unc79 UTSW 12 103113200 missense probably benign 0.18
R0310:Unc79 UTSW 12 103061407 missense probably damaging 1.00
R0325:Unc79 UTSW 12 103171644 missense probably damaging 0.98
R0369:Unc79 UTSW 12 103088772 critical splice donor site probably null
R0450:Unc79 UTSW 12 103079070 critical splice donor site probably null
R0503:Unc79 UTSW 12 103078868 missense probably benign 0.01
R0542:Unc79 UTSW 12 103094178 splice site probably benign
R0845:Unc79 UTSW 12 103173444 splice site probably benign
R0893:Unc79 UTSW 12 102991428 missense probably damaging 1.00
R1078:Unc79 UTSW 12 103074853 missense probably benign 0.03
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1148:Unc79 UTSW 12 103112667 missense probably damaging 1.00
R1159:Unc79 UTSW 12 103047052 splice site probably benign
R1191:Unc79 UTSW 12 103047012 nonsense probably null
R1307:Unc79 UTSW 12 103070076 missense probably damaging 1.00
R1368:Unc79 UTSW 12 103156513 missense probably damaging 1.00
R1476:Unc79 UTSW 12 103183525 missense probably damaging 1.00
R1650:Unc79 UTSW 12 103112793 missense possibly damaging 0.85
R1777:Unc79 UTSW 12 103112455 missense probably damaging 1.00
R1796:Unc79 UTSW 12 103142746 missense probably damaging 0.99
R1824:Unc79 UTSW 12 103059320 missense probably damaging 1.00
R1830:Unc79 UTSW 12 103134478 missense probably damaging 1.00
R1927:Unc79 UTSW 12 103169692 missense probably damaging 1.00
R1958:Unc79 UTSW 12 102991362 missense probably damaging 1.00
R1958:Unc79 UTSW 12 103074919 missense probably benign 0.19
R1980:Unc79 UTSW 12 103011279 nonsense probably null
R2019:Unc79 UTSW 12 103171571 critical splice acceptor site probably null
R2290:Unc79 UTSW 12 103146366 missense probably damaging 1.00
R2939:Unc79 UTSW 12 102991425 missense probably damaging 1.00
R2962:Unc79 UTSW 12 103095119 missense possibly damaging 0.72
R3176:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3276:Unc79 UTSW 12 103113217 missense probably damaging 1.00
R3683:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3684:Unc79 UTSW 12 103074803 missense probably benign 0.00
R3686:Unc79 UTSW 12 103088661 missense probably damaging 1.00
R3760:Unc79 UTSW 12 103092705 missense probably damaging 1.00
R4031:Unc79 UTSW 12 103072759 missense possibly damaging 0.46
R4039:Unc79 UTSW 12 103074949 missense possibly damaging 0.88
R4110:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4113:Unc79 UTSW 12 103059370 missense probably damaging 1.00
R4159:Unc79 UTSW 12 103070253 intron probably benign
R4273:Unc79 UTSW 12 103122353 missense probably damaging 0.99
R4292:Unc79 UTSW 12 103183444 missense probably damaging 0.99
R4334:Unc79 UTSW 12 103078974 missense probably benign
R4513:Unc79 UTSW 12 103021760 missense probably damaging 1.00
R4562:Unc79 UTSW 12 102991461 missense probably damaging 1.00
R4576:Unc79 UTSW 12 103001803 splice site probably benign
R4645:Unc79 UTSW 12 103112822 missense probably benign
R4758:Unc79 UTSW 12 103161821 nonsense probably null
R4787:Unc79 UTSW 12 103046998 missense probably damaging 1.00
R4852:Unc79 UTSW 12 103173466 missense probably damaging 0.98
R4883:Unc79 UTSW 12 103094333 missense probably damaging 0.99
R4979:Unc79 UTSW 12 103112432 missense probably benign
R5044:Unc79 UTSW 12 103112703 missense probably benign 0.32
R5053:Unc79 UTSW 12 103104748 missense probably damaging 1.00
R5061:Unc79 UTSW 12 103168441 missense possibly damaging 0.94
R5075:Unc79 UTSW 12 103074954 missense possibly damaging 0.63
R5101:Unc79 UTSW 12 103112510 missense probably damaging 1.00
R5236:Unc79 UTSW 12 103094395 critical splice donor site probably null
R5240:Unc79 UTSW 12 103070751 missense probably damaging 0.99
R5383:Unc79 UTSW 12 103104627 missense possibly damaging 0.53
R5461:Unc79 UTSW 12 103112138 missense probably damaging 1.00
R5535:Unc79 UTSW 12 103169703 missense possibly damaging 0.84
R5609:Unc79 UTSW 12 103128268 missense probably benign
R5639:Unc79 UTSW 12 103171572 missense probably damaging 1.00
R5704:Unc79 UTSW 12 103001943 missense probably damaging 1.00
R5923:Unc79 UTSW 12 103112468 missense probably damaging 1.00
R5925:Unc79 UTSW 12 103125730 splice site probably null
R5975:Unc79 UTSW 12 103125626 missense possibly damaging 0.53
R6047:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6156:Unc79 UTSW 12 103061458 missense probably damaging 1.00
R6175:Unc79 UTSW 12 103183449 missense probably damaging 0.98
R6292:Unc79 UTSW 12 103142732 missense possibly damaging 0.88
R6313:Unc79 UTSW 12 103112619 missense probably damaging 1.00
R6391:Unc79 UTSW 12 103021010 missense probably damaging 1.00
R6405:Unc79 UTSW 12 103168336 missense probably damaging 0.97
R6416:Unc79 UTSW 12 103131646 missense possibly damaging 0.86
R6467:Unc79 UTSW 12 103173512 missense probably damaging 1.00
R6573:Unc79 UTSW 12 103061388 missense probably damaging 1.00
R6614:Unc79 UTSW 12 102991430 missense probably damaging 1.00
R6654:Unc79 UTSW 12 103079048 missense probably damaging 0.99
R6654:Unc79 UTSW 12 103079049 missense probably damaging 1.00
R6700:Unc79 UTSW 12 103125703 missense possibly damaging 0.92
R6724:Unc79 UTSW 12 103104861 missense probably damaging 1.00
R6819:Unc79 UTSW 12 103142008 missense probably benign 0.12
R6869:Unc79 UTSW 12 103113072 missense probably benign 0.33
R6879:Unc79 UTSW 12 103148787 intron probably null
R6942:Unc79 UTSW 12 103122445 critical splice donor site probably null
R6961:Unc79 UTSW 12 103112915 missense probably damaging 1.00
R6973:Unc79 UTSW 12 102998440 missense possibly damaging 0.86
R6980:Unc79 UTSW 12 103059500 missense probably damaging 1.00
R7124:Unc79 UTSW 12 103061393 missense probably damaging 0.99
R7144:Unc79 UTSW 12 103142626 missense probably benign 0.06
R7197:Unc79 UTSW 12 103112506 missense probably benign
R7209:Unc79 UTSW 12 103125624 missense probably benign
R7232:Unc79 UTSW 12 103134475 missense possibly damaging 0.49
R7304:Unc79 UTSW 12 103063190 missense probably damaging 1.00
R7354:Unc79 UTSW 12 103142702 missense possibly damaging 0.79
R7384:Unc79 UTSW 12 103171578 missense probably benign 0.11
R7400:Unc79 UTSW 12 103104630 missense probably damaging 1.00
R7417:Unc79 UTSW 12 103088758 missense possibly damaging 0.85
R7470:Unc79 UTSW 12 103094976 missense probably damaging 1.00
R7842:Unc79 UTSW 12 103092054 missense probably damaging 1.00
R7925:Unc79 UTSW 12 103092054 missense probably damaging 1.00
R7989:Unc79 UTSW 12 103063089 intron probably null
R8037:Unc79 UTSW 12 103049919 missense probably damaging 1.00
R8041:Unc79 UTSW 12 103088467 missense probably benign 0.06
RF010:Unc79 UTSW 12 103112787 missense probably benign 0.17
X0017:Unc79 UTSW 12 103108261 missense probably damaging 0.99
X0028:Unc79 UTSW 12 102991403 missense probably damaging 1.00
Z1088:Unc79 UTSW 12 103021012 missense probably damaging 1.00
Z1176:Unc79 UTSW 12 103088678 missense probably damaging 1.00
Z1176:Unc79 UTSW 12 103142053 missense probably benign 0.03
Z1177:Unc79 UTSW 12 103165689 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGATAGGGACGAACCACCATG -3'
(R):5'- GCTGTTTCTCAACATGGACG -3'

Sequencing Primer
(F):5'- ACCACCATGATGAGCAGGTCTG -3'
(R):5'- CTGTTTCTCAACATGGACGACAAGG -3'
Posted On2016-03-17