Incidental Mutation 'R0282:Sycp1'
ID37600
Institutional Source Beutler Lab
Gene Symbol Sycp1
Ensembl Gene ENSMUSG00000027855
Gene Namesynaptonemal complex protein 1
SynonymsSCP1
MMRRC Submission 038504-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.514) question?
Stock #R0282 (G1)
Quality Score135
Status Validated
Chromosome3
Chromosomal Location102818499-102936100 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to G at 102915795 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000143651 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029448] [ENSMUST00000196988]
Predicted Effect probably benign
Transcript: ENSMUST00000029448
SMART Domains Protein: ENSMUSP00000029448
Gene: ENSMUSG00000027855

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196988
SMART Domains Protein: ENSMUSP00000143651
Gene: ENSMUSG00000027855

DomainStartEndE-ValueType
Pfam:SCP-1 28 809 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (72/72)
MGI Phenotype PHENOTYPE: Homozygous null mice display male and female infertility, azoospermia, small ovary, small testis and seminiferous tubules, absent ovarian follicles, and failure of synapse formation during meiosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
1700123L14Rik T C 6: 96,164,816 T416A probably benign Het
Afap1l2 A G 19: 56,916,221 S549P possibly damaging Het
Alcam A T 16: 52,295,741 C157S probably damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Ano8 G A 8: 71,480,614 probably benign Het
Atr T C 9: 95,862,798 V56A probably benign Het
Aurkc T A 7: 7,002,428 probably null Het
Bnip3 T C 7: 138,898,030 D76G probably damaging Het
Cbr1 A G 16: 93,610,134 E246G possibly damaging Het
Ccdc157 G T 11: 4,146,708 A449D probably damaging Het
Ces3b T A 8: 105,083,851 V26D probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crk G T 11: 75,703,369 G261C probably damaging Het
Ctbp1 A G 5: 33,250,856 probably null Het
Ctnna1 G A 18: 35,244,122 V572I possibly damaging Het
D430041D05Rik T C 2: 104,201,244 Y1669C probably damaging Het
Dnah8 T C 17: 30,736,156 F2053S probably damaging Het
Dner G A 1: 84,405,965 T566M probably damaging Het
Dner A G 1: 84,445,380 probably benign Het
Edrf1 T C 7: 133,644,022 V223A probably benign Het
Fam169a A G 13: 97,097,715 probably benign Het
Fbxl3 G A 14: 103,095,225 H106Y probably damaging Het
Fiz1 A G 7: 5,009,201 V106A probably benign Het
Gapvd1 T A 2: 34,688,960 R654* probably null Het
Gm7589 G A 9: 59,146,005 noncoding transcript Het
Ifi202b A T 1: 173,977,360 S9T probably benign Het
Ipmk G C 10: 71,372,831 S149T probably benign Het
Irgm2 A G 11: 58,219,519 E24G probably benign Het
Itga2b A C 11: 102,460,846 V551G probably damaging Het
Itgad C T 7: 128,189,978 probably benign Het
Kcnh8 T A 17: 52,725,851 F55L probably damaging Het
Kdr G A 5: 75,950,100 probably benign Het
Krt35 T C 11: 100,095,747 Y147C probably damaging Het
Lamc1 A G 1: 153,255,312 F298L probably benign Het
Lrrk2 T C 15: 91,778,414 probably benign Het
Matn1 T C 4: 130,945,927 S69P probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Msto1 A G 3: 88,911,577 V257A possibly damaging Het
Mybpc3 G C 2: 91,124,024 probably benign Het
Mycn A G 12: 12,937,313 V361A probably benign Het
Myo10 A G 15: 25,793,167 T1277A probably damaging Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Olfr1199 G A 2: 88,756,456 T73I probably damaging Het
Olfr1510 A G 14: 52,410,263 V203A possibly damaging Het
Olfr267 A G 4: 58,785,344 I126T probably damaging Het
Olfr504 T A 7: 108,565,477 Q106L probably damaging Het
Otog C T 7: 46,277,493 T1222I possibly damaging Het
P4ha1 C T 10: 59,337,148 T23M probably damaging Het
Pld1 A T 3: 28,078,273 I537F probably benign Het
Plekhn1 A G 4: 156,228,323 probably benign Het
Pxdn C A 12: 29,984,440 S8* probably null Het
Rnf135 A T 11: 80,193,958 I186F probably damaging Het
Rock2 T C 12: 16,977,886 probably benign Het
Rph3a C A 5: 120,963,910 G88* probably null Het
Sarm1 G A 11: 78,474,980 Q740* probably null Het
Setd1b C A 5: 123,161,017 probably benign Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Slc2a4 A T 11: 69,946,355 V85E probably damaging Het
Swi5 A G 2: 32,280,754 Y54H probably damaging Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tmem67 G A 4: 12,087,930 T72M probably damaging Het
Tor1a A G 2: 30,967,725 Y44H possibly damaging Het
Ttll5 T C 12: 85,996,053 Y1128H probably benign Het
Usp40 G A 1: 87,980,958 probably benign Het
Vmn2r18 A T 5: 151,585,203 M152K probably benign Het
Xirp2 T A 2: 67,513,380 D1988E probably damaging Het
Zfp420 A G 7: 29,875,680 I442V probably benign Het
Zyx A G 6: 42,356,005 E363G probably damaging Het
Other mutations in Sycp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Sycp1 APN 3 102840962 missense probably benign
IGL00833:Sycp1 APN 3 102876301 critical splice donor site probably null
IGL01066:Sycp1 APN 3 102920634 missense probably damaging 1.00
IGL01484:Sycp1 APN 3 102915867 missense probably benign 0.01
IGL02139:Sycp1 APN 3 102865114 missense probably benign 0.00
IGL02270:Sycp1 APN 3 102895943 missense probably benign 0.12
IGL02347:Sycp1 APN 3 102893547 missense probably benign 0.00
IGL02630:Sycp1 APN 3 102878764 splice site probably benign
IGL02668:Sycp1 APN 3 102820531 splice site probably benign
IGL02928:Sycp1 APN 3 102818818 utr 3 prime probably benign
PIT4458001:Sycp1 UTSW 3 102934833 missense probably benign 0.01
R0027:Sycp1 UTSW 3 102895910 missense probably benign
R0462:Sycp1 UTSW 3 102819106 missense possibly damaging 0.75
R0609:Sycp1 UTSW 3 102898849 splice site probably null
R0837:Sycp1 UTSW 3 102915245 missense probably benign 0.17
R1301:Sycp1 UTSW 3 102920622 missense probably benign 0.02
R2408:Sycp1 UTSW 3 102925259 missense probably damaging 1.00
R2449:Sycp1 UTSW 3 102925206 missense probably benign 0.15
R2516:Sycp1 UTSW 3 102845066 missense probably benign 0.09
R2880:Sycp1 UTSW 3 102818898 missense probably damaging 0.99
R3410:Sycp1 UTSW 3 102841041 missense possibly damaging 0.94
R3427:Sycp1 UTSW 3 102876350 missense probably benign 0.00
R4538:Sycp1 UTSW 3 102840962 missense probably benign
R4679:Sycp1 UTSW 3 102922462 critical splice acceptor site probably null
R4707:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R4785:Sycp1 UTSW 3 102853489 missense possibly damaging 0.92
R5017:Sycp1 UTSW 3 102895987 splice site probably null
R5036:Sycp1 UTSW 3 102820600 missense probably damaging 1.00
R5044:Sycp1 UTSW 3 102845054 missense probably benign 0.03
R5070:Sycp1 UTSW 3 102920565 missense probably damaging 0.97
R5079:Sycp1 UTSW 3 102878800 missense possibly damaging 0.67
R5289:Sycp1 UTSW 3 102934253 missense possibly damaging 0.85
R5393:Sycp1 UTSW 3 102841047 splice site probably null
R5477:Sycp1 UTSW 3 102818890 missense probably damaging 1.00
R5576:Sycp1 UTSW 3 102818902 missense probably damaging 0.98
R5814:Sycp1 UTSW 3 102895897 missense probably benign 0.03
R6291:Sycp1 UTSW 3 102908961 missense probably damaging 1.00
R6460:Sycp1 UTSW 3 102925253 missense probably damaging 1.00
R6527:Sycp1 UTSW 3 102898887 missense probably benign 0.09
R6870:Sycp1 UTSW 3 102935603 missense probably damaging 1.00
R6873:Sycp1 UTSW 3 102840980 missense probably benign
R7037:Sycp1 UTSW 3 102898934 missense possibly damaging 0.62
R7210:Sycp1 UTSW 3 102853492 missense probably damaging 1.00
R7405:Sycp1 UTSW 3 102925227 missense possibly damaging 0.72
R7604:Sycp1 UTSW 3 102913433 missense probably damaging 0.98
R7733:Sycp1 UTSW 3 102895962 missense probably benign 0.00
R7858:Sycp1 UTSW 3 102898957 missense probably benign 0.09
R7909:Sycp1 UTSW 3 102820626 nonsense probably null
R8109:Sycp1 UTSW 3 102851602 missense probably benign 0.21
R8141:Sycp1 UTSW 3 102935569 missense possibly damaging 0.73
R8289:Sycp1 UTSW 3 102841037 missense probably benign 0.01
R8359:Sycp1 UTSW 3 102820593 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GCAGTTAGCCCACACAGTTCTCTC -3'
(R):5'- GCCCTTGACTCCTTGACAGCAATG -3'

Sequencing Primer
(F):5'- CCACTCTTAGAACTGTTAATGACTC -3'
(R):5'- GACTCCTTGACAGCAATGTACAAATG -3'
Posted On2013-05-23