Incidental Mutation 'R4899:Cit'
ID376003
Institutional Source Beutler Lab
Gene Symbol Cit
Ensembl Gene ENSMUSG00000029516
Gene Namecitron
SynonymsCRIK-SK, C030025P15Rik, Cit-k, citron-N, citron kinase
MMRRC Submission 042503-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.937) question?
Stock #R4899 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location115845278-116008947 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 115863028 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 162 (Y162C)
Ref Sequence ENSEMBL: ENSMUSP00000122745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051704] [ENSMUST00000102560] [ENSMUST00000112008] [ENSMUST00000137952] [ENSMUST00000141101] [ENSMUST00000148245]
Predicted Effect probably benign
Transcript: ENSMUST00000051704
AA Change: Y162C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000062049
Gene: ENSMUSG00000029516
AA Change: Y162C

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 891 905 N/A INTRINSIC
low complexity region 915 948 N/A INTRINSIC
low complexity region 950 968 N/A INTRINSIC
low complexity region 1068 1081 N/A INTRINSIC
low complexity region 1138 1156 N/A INTRINSIC
low complexity region 1182 1203 N/A INTRINSIC
internal_repeat_1 1243 1282 1.05e-5 PROSPERO
low complexity region 1353 1364 N/A INTRINSIC
C1 1389 1437 1.97e-9 SMART
PH 1470 1591 1.31e-8 SMART
CNH 1618 1915 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000102560
AA Change: Y162C

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000099620
Gene: ENSMUSG00000029516
AA Change: Y162C

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1244 N/A INTRINSIC
coiled coil region 1297 1338 N/A INTRINSIC
low complexity region 1368 1379 N/A INTRINSIC
C1 1404 1452 1.97e-9 SMART
PH 1485 1606 1.31e-8 SMART
CNH 1633 1930 1.78e-112 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112008
AA Change: Y162C

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000107639
Gene: ENSMUSG00000029516
AA Change: Y162C

DomainStartEndE-ValueType
S_TKc 97 359 2.92e-89 SMART
S_TK_X 360 422 6.32e-16 SMART
coiled coil region 452 1202 N/A INTRINSIC
coiled coil region 1255 1296 N/A INTRINSIC
low complexity region 1326 1337 N/A INTRINSIC
C1 1362 1410 1.97e-9 SMART
PH 1443 1564 1.31e-8 SMART
CNH 1591 1888 1.78e-112 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127976
SMART Domains Protein: ENSMUSP00000135649
Gene: ENSMUSG00000029516

DomainStartEndE-ValueType
Pfam:Pkinase 60 124 4.6e-5 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000137952
AA Change: Y162C

PolyPhen 2 Score 0.599 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122745
Gene: ENSMUSG00000029516
AA Change: Y162C

DomainStartEndE-ValueType
Pfam:Pkinase 97 175 9.4e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141101
AA Change: Y162C

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000115802
Gene: ENSMUSG00000029516
AA Change: Y162C

DomainStartEndE-ValueType
S_TKc 97 359 1.4e-91 SMART
S_TK_X 360 422 3e-18 SMART
low complexity region 632 646 N/A INTRINSIC
low complexity region 686 698 N/A INTRINSIC
low complexity region 849 863 N/A INTRINSIC
low complexity region 873 906 N/A INTRINSIC
low complexity region 908 926 N/A INTRINSIC
low complexity region 1026 1039 N/A INTRINSIC
low complexity region 1096 1114 N/A INTRINSIC
low complexity region 1140 1161 N/A INTRINSIC
internal_repeat_1 1201 1240 1.73e-5 PROSPERO
low complexity region 1311 1322 N/A INTRINSIC
C1 1347 1395 9.7e-12 SMART
PH 1428 1549 6e-11 SMART
CNH 1576 1873 8.6e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147330
Predicted Effect probably benign
Transcript: ENSMUST00000148245
AA Change: Y162C

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000119769
Gene: ENSMUSG00000029516
AA Change: Y162C

DomainStartEndE-ValueType
Pfam:Pkinase 97 181 7.6e-12 PFAM
Pfam:Pkinase_Tyr 97 181 9.5e-6 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a serine/threonine-protein kinase that functions in cell division. Together with the kinesin KIF14, this protein localizes to the central spindle and midbody, and functions to promote efficient cytokinesis. This protein is involved in central nervous system development. Polymorphisms in this gene are associated with bipolar disorder and risk for schizophrenia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygotes for a null mutation are 20% smaller than wild-type and exhibit tremors, ataxia, and fatal seizures. Brains of mutant mice show a 50% size reduction with abnormalities in the hippocampus, cerebellum, and olfactory lobes. Mutant males show aberrant cytokinesis of spermatogenic precursors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A T 16: 36,257,365 Y96F possibly damaging Het
9230110C19Rik A T 9: 8,022,493 S243T possibly damaging Het
Abhd18 C G 3: 40,905,869 probably null Het
Adra2c A T 5: 35,280,361 Y159F probably damaging Het
AI481877 T C 4: 59,062,640 Y872C probably damaging Het
Alkal2 T A 12: 30,884,973 S64T probably benign Het
Apbb1ip T C 2: 22,823,349 V72A unknown Het
Atp13a5 A G 16: 29,378,500 L13P probably damaging Het
Azin2 G A 4: 128,934,653 P254S probably benign Het
Bmpr1b T C 3: 141,840,683 R481G probably damaging Het
Cacna2d4 G A 6: 119,268,196 W288* probably null Het
Cass4 A G 2: 172,427,869 T626A probably benign Het
Cep112 T A 11: 108,606,284 D683E probably damaging Het
Chat G T 14: 32,448,977 S188R possibly damaging Het
Clca3a1 T A 3: 144,737,961 Y676F probably damaging Het
Clec2h A G 6: 128,675,824 N185D probably benign Het
Cnbd2 G T 2: 156,339,221 V192F probably benign Het
Col6a3 C A 1: 90,802,427 G1112V probably damaging Het
Cyp3a25 A G 5: 145,977,671 F483S possibly damaging Het
Dscam T C 16: 96,683,818 E1103G probably benign Het
Dync2h1 G A 9: 7,131,921 Q1629* probably null Het
E330014E10Rik T C 5: 95,801,727 V111A probably benign Het
Enpp6 A G 8: 46,987,083 Y38C probably damaging Het
Epg5 T A 18: 77,985,057 L1271Q probably damaging Het
Fam47e G A 5: 92,574,669 V75I probably benign Het
Fat3 T C 9: 15,969,799 D3259G probably damaging Het
Fbxw28 T C 9: 109,330,853 D211G probably damaging Het
Flnc A G 6: 29,446,843 N990D probably benign Het
Frat1 T G 19: 41,830,322 L52R probably damaging Het
Ftmt C G 18: 52,331,586 probably benign Het
H2-M1 C T 17: 36,671,220 G163D probably benign Het
Hapln1 A G 13: 89,601,650 K105E possibly damaging Het
Igkv17-127 G T 6: 67,861,397 A31S probably benign Het
Il6st T C 13: 112,501,161 L628P probably damaging Het
Kcnj6 A G 16: 94,832,613 I213T probably damaging Het
Kidins220 T C 12: 25,013,443 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Marc2 A T 1: 184,845,624 I65N probably damaging Het
Mertk C A 2: 128,783,925 P660Q probably damaging Het
Mkl1 A G 15: 81,018,386 Y241H probably damaging Het
Napepld A G 5: 21,683,440 Y4H probably benign Het
Ncam1 T A 9: 49,545,251 probably null Het
Nuak2 A T 1: 132,324,986 K93* probably null Het
Oat A T 7: 132,564,222 D211E probably benign Het
Olfr1214 A C 2: 88,988,110 L31V probably null Het
Olfr1355 A T 10: 78,879,207 S12C probably benign Het
Olfr171 G A 16: 19,624,200 A300V probably benign Het
Olfr348 A G 2: 36,786,798 Q91R probably benign Het
Olfr64 A G 7: 103,893,465 I90T possibly damaging Het
Pde4dip C A 3: 97,709,558 K1789N probably damaging Het
Piezo2 T C 18: 63,078,791 I1322V possibly damaging Het
Pih1d1 A G 7: 45,154,527 probably benign Het
Plekhd1 T C 12: 80,722,327 S454P probably damaging Het
Polr2h G A 16: 20,720,553 V89M probably damaging Het
Pptc7 G A 5: 122,284,717 G17S possibly damaging Het
Ptpra T C 2: 130,544,436 V602A probably damaging Het
Rnf123 C T 9: 108,063,680 R654H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 A G 16: 75,879,103 S135P probably damaging Het
Sgsm3 A G 15: 81,006,779 N147S probably benign Het
Slc22a29 T C 19: 8,161,569 T510A probably benign Het
Smc4 T A 3: 69,031,811 H978Q probably damaging Het
Sox7 G A 14: 63,948,478 R321H probably damaging Het
Spred3 T C 7: 29,161,833 D307G probably damaging Het
Syne2 T A 12: 75,854,101 D11E probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Top2b A T 14: 16,387,313 I134F probably damaging Het
Tspan1 T A 4: 116,163,366 R206* probably null Het
Ttc3 A T 16: 94,429,455 N837I probably damaging Het
Vmn1r36 T C 6: 66,716,565 T72A possibly damaging Het
Vmn2r10 A G 5: 109,003,458 S97P probably damaging Het
Zfp2 T A 11: 50,900,014 I401F probably damaging Het
Zfp629 T C 7: 127,611,018 T540A possibly damaging Het
Zfr G A 15: 12,166,145 V834I probably benign Het
Other mutations in Cit
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00321:Cit APN 5 115846465 missense probably damaging 0.99
IGL00482:Cit APN 5 115938755 missense probably damaging 0.97
IGL01317:Cit APN 5 115908716 missense probably benign 0.03
IGL01335:Cit APN 5 115908830 splice site probably benign
IGL01415:Cit APN 5 115941903 missense possibly damaging 0.78
IGL01447:Cit APN 5 115873843 splice site probably benign
IGL01537:Cit APN 5 115933854 missense probably benign 0.00
IGL01621:Cit APN 5 115992603 splice site probably benign
IGL02010:Cit APN 5 115875947 missense probably damaging 1.00
IGL02538:Cit APN 5 115986989 nonsense probably null
IGL02607:Cit APN 5 115859209 missense probably benign
IGL02720:Cit APN 5 115995452 missense probably benign 0.26
IGL02725:Cit APN 5 115985473 missense probably benign 0.02
IGL02967:Cit APN 5 115945837 missense probably benign 0.11
IGL02973:Cit APN 5 116005999 missense possibly damaging 0.73
IGL03383:Cit APN 5 115873845 splice site probably benign
PIT4514001:Cit UTSW 5 115997854 critical splice donor site probably null
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0206:Cit UTSW 5 115994030 missense possibly damaging 0.72
R0226:Cit UTSW 5 115984840 missense probably damaging 0.99
R0320:Cit UTSW 5 115979445 missense possibly damaging 0.87
R0401:Cit UTSW 5 115985479 missense probably benign 0.06
R0480:Cit UTSW 5 115933393 splice site probably benign
R0609:Cit UTSW 5 115873943 missense probably damaging 0.98
R0737:Cit UTSW 5 115946919 missense probably damaging 1.00
R1238:Cit UTSW 5 115851221 missense probably benign 0.30
R1503:Cit UTSW 5 115873900 missense possibly damaging 0.94
R1551:Cit UTSW 5 115945842 missense probably benign 0.00
R1602:Cit UTSW 5 115997730 missense probably damaging 1.00
R1720:Cit UTSW 5 115967897 missense probably damaging 0.98
R1854:Cit UTSW 5 115873901 missense probably damaging 1.00
R1886:Cit UTSW 5 115933486 missense probably damaging 1.00
R2024:Cit UTSW 5 115947924 missense probably damaging 0.97
R2024:Cit UTSW 5 116005840 missense probably damaging 0.97
R2048:Cit UTSW 5 115886813 splice site probably null
R2128:Cit UTSW 5 115985507 missense possibly damaging 0.63
R2192:Cit UTSW 5 115968009 missense probably benign 0.00
R2244:Cit UTSW 5 115926505 missense probably damaging 1.00
R2518:Cit UTSW 5 115987046 missense probably damaging 0.99
R2679:Cit UTSW 5 115969115 missense probably benign 0.00
R2898:Cit UTSW 5 115873978 splice site probably null
R2908:Cit UTSW 5 115981676 missense probably benign 0.00
R3079:Cit UTSW 5 115925486 missense probably damaging 0.97
R3779:Cit UTSW 5 115859341 missense probably benign 0.01
R4081:Cit UTSW 5 115948050 missense probably damaging 1.00
R4494:Cit UTSW 5 115873984 missense probably damaging 1.00
R4610:Cit UTSW 5 115994087 missense probably benign 0.01
R4757:Cit UTSW 5 115997549 missense probably damaging 1.00
R4788:Cit UTSW 5 115933506 missense probably damaging 1.00
R4816:Cit UTSW 5 115908691 missense probably damaging 1.00
R4890:Cit UTSW 5 115988123 intron probably benign
R4928:Cit UTSW 5 115985797 missense probably benign 0.00
R5073:Cit UTSW 5 115946843 missense probably benign 0.24
R5151:Cit UTSW 5 115979835 missense probably damaging 1.00
R5154:Cit UTSW 5 115988405 missense probably damaging 1.00
R5222:Cit UTSW 5 115952543 missense probably benign 0.03
R5814:Cit UTSW 5 115979419 missense probably damaging 1.00
R5935:Cit UTSW 5 115925539 intron probably benign
R5946:Cit UTSW 5 115997534 missense probably damaging 1.00
R6051:Cit UTSW 5 115846405 missense probably benign
R6289:Cit UTSW 5 116006326 makesense probably null
R6298:Cit UTSW 5 115948065 missense probably damaging 1.00
R6362:Cit UTSW 5 115886676 missense probably benign 0.01
R6545:Cit UTSW 5 115846434 missense probably null 0.00
R6761:Cit UTSW 5 115908675 missense probably damaging 1.00
R6798:Cit UTSW 5 115926526 missense possibly damaging 0.56
R6814:Cit UTSW 5 115884963 missense probably damaging 1.00
R6825:Cit UTSW 5 115981774 missense probably damaging 0.99
R6845:Cit UTSW 5 115984888 missense probably damaging 1.00
R6983:Cit UTSW 5 115994091 missense probably damaging 1.00
R7164:Cit UTSW 5 115985787 missense possibly damaging 0.94
R7359:Cit UTSW 5 115926574 missense probably damaging 1.00
R7597:Cit UTSW 5 115886681 nonsense probably null
R7729:Cit UTSW 5 115984822 missense possibly damaging 0.87
R7763:Cit UTSW 5 115987001 missense probably benign 0.01
R7786:Cit UTSW 5 115863018 missense probably benign 0.00
R7799:Cit UTSW 5 115862968 missense probably benign 0.00
R8060:Cit UTSW 5 115908727 missense probably benign 0.00
R8068:Cit UTSW 5 115952466 missense probably damaging 1.00
R8068:Cit UTSW 5 115982235 missense probably benign 0.03
R8122:Cit UTSW 5 115969010 missense probably damaging 1.00
R8177:Cit UTSW 5 115988159 missense probably benign 0.18
R8178:Cit UTSW 5 115969072 missense probably damaging 1.00
R8265:Cit UTSW 5 115988177 missense probably damaging 1.00
R8397:Cit UTSW 5 115886797 missense probably benign
Z1088:Cit UTSW 5 115985533 missense possibly damaging 0.62
Z1176:Cit UTSW 5 115986603 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGTGACATGCTAAGCG -3'
(R):5'- GGTCAGCTCTTAATCATTAGAACAGG -3'

Sequencing Primer
(F):5'- TGCTAAGCGATTTTTAATATCCAGAG -3'
(R):5'- GCTCTTAATCATTAGAACAGGGAACG -3'
Posted On2016-03-17