Mutagenetix > Incidental Mutation

Incidental Mutation 'R4899:Top2b'

376035

Institutional Source

Beutler Lab

Gene Symbol

Top2b

Ensembl Gene

ENSMUSG00000017485

Gene Name

topoisomerase (DNA) II beta

Synonyms

D230016L12Rik, Top-2

MMRRC Submission

042503-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.929) question?

Stock #

R4899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

16365179-16435462 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 16387313 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Phenylalanine at position 134 (I134F)

Ref Sequence

ENSEMBL: ENSMUSP00000017629 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000017629]

AlphaFold

Q64511

Predicted Effect

probably damaging
Transcript: ENSMUST00000017629
AA Change: I134F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000017629
Gene: ENSMUSG00000017485
AA Change: I134F

Domain	Start	End	E-Value	Type
Blast:TOP2c	32	70	7e-10	BLAST
HATPase_c	85	234	1.91e-2	SMART
TOP2c	89	679	N/A	SMART
TOP4c	702	1175	2.55e-230	SMART
low complexity region	1201	1215	N/A	INTRINSIC
low complexity region	1287	1299	N/A	INTRINSIC
low complexity region	1324	1336	N/A	INTRINSIC
low complexity region	1360	1382	N/A	INTRINSIC
Pfam:DTHCT	1495	1597	4.6e-31	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000159987

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a DNA topoisomerase, an enzyme that controls and alters the topologic states of DNA during transcription. This nuclear enzyme is involved in processes such as chromosome condensation, chromatid separation, and the relief of torsional stress that occurs during DNA transcription and replication. It catalyzes the transient breaking and rejoining of two strands of duplex DNA which allows the strands to pass through one another, thus altering the topology of DNA. Two forms of this enzyme exist as likely products of a gene duplication event. The gene encoding this form, beta, is localized to chromosome 3 and the alpha form is localized to chromosome 17. The gene encoding this enzyme functions as the target for several anticancer agents and a variety of mutations in this gene have been associated with the development of drug resistance. Reduced activity of this enzyme may also play a role in ataxia-telangiectasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygous null mice exhibit abnormal innervation. Offspring die shortly after birth due to respiratory failure. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010005H15Rik	A	T	16: 36,257,365	Y96F	possibly damaging	Het
9230110C19Rik	A	T	9: 8,022,493	S243T	possibly damaging	Het
Abhd18	C	G	3: 40,905,869		probably null	Het
Adra2c	A	T	5: 35,280,361	Y159F	probably damaging	Het
AI481877	T	C	4: 59,062,640	Y872C	probably damaging	Het
Alkal2	T	A	12: 30,884,973	S64T	probably benign	Het
Apbb1ip	T	C	2: 22,823,349	V72A	unknown	Het
Atp13a5	A	G	16: 29,378,500	L13P	probably damaging	Het
Azin2	G	A	4: 128,934,653	P254S	probably benign	Het
Bmpr1b	T	C	3: 141,840,683	R481G	probably damaging	Het
Cacna2d4	G	A	6: 119,268,196	W288*	probably null	Het
Cass4	A	G	2: 172,427,869	T626A	probably benign	Het
Cep112	T	A	11: 108,606,284	D683E	probably damaging	Het
Chat	G	T	14: 32,448,977	S188R	possibly damaging	Het
Cit	A	G	5: 115,863,028	Y162C	possibly damaging	Het
Clca3a1	T	A	3: 144,737,961	Y676F	probably damaging	Het
Clec2h	A	G	6: 128,675,824	N185D	probably benign	Het
Cnbd2	G	T	2: 156,339,221	V192F	probably benign	Het
Col6a3	C	A	1: 90,802,427	G1112V	probably damaging	Het
Cyp3a25	A	G	5: 145,977,671	F483S	possibly damaging	Het
Dscam	T	C	16: 96,683,818	E1103G	probably benign	Het
Dync2h1	G	A	9: 7,131,921	Q1629*	probably null	Het
E330014E10Rik	T	C	5: 95,801,727	V111A	probably benign	Het
Enpp6	A	G	8: 46,987,083	Y38C	probably damaging	Het
Epg5	T	A	18: 77,985,057	L1271Q	probably damaging	Het
Fam47e	G	A	5: 92,574,669	V75I	probably benign	Het
Fat3	T	C	9: 15,969,799	D3259G	probably damaging	Het
Fbxw28	T	C	9: 109,330,853	D211G	probably damaging	Het
Flnc	A	G	6: 29,446,843	N990D	probably benign	Het
Frat1	T	G	19: 41,830,322	L52R	probably damaging	Het
Ftmt	C	G	18: 52,331,586		probably benign	Het
H2-M1	C	T	17: 36,671,220	G163D	probably benign	Het
Hapln1	A	G	13: 89,601,650	K105E	possibly damaging	Het
Igkv17-127	G	T	6: 67,861,397	A31S	probably benign	Het
Il6st	T	C	13: 112,501,161	L628P	probably damaging	Het
Kcnj6	A	G	16: 94,832,613	I213T	probably damaging	Het
Kidins220	T	C	12: 25,013,443		probably null	Het
Lama2	TTTGCGCATT	TTT	10: 27,043,643		probably null	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Marc2	A	T	1: 184,845,624	I65N	probably damaging	Het
Mertk	C	A	2: 128,783,925	P660Q	probably damaging	Het
Mkl1	A	G	15: 81,018,386	Y241H	probably damaging	Het
Napepld	A	G	5: 21,683,440	Y4H	probably benign	Het
Ncam1	T	A	9: 49,545,251		probably null	Het
Nuak2	A	T	1: 132,324,986	K93*	probably null	Het
Oat	A	T	7: 132,564,222	D211E	probably benign	Het
Olfr1214	A	C	2: 88,988,110	L31V	probably null	Het
Olfr1355	A	T	10: 78,879,207	S12C	probably benign	Het
Olfr171	G	A	16: 19,624,200	A300V	probably benign	Het
Olfr348	A	G	2: 36,786,798	Q91R	probably benign	Het
Olfr64	A	G	7: 103,893,465	I90T	possibly damaging	Het
Pde4dip	C	A	3: 97,709,558	K1789N	probably damaging	Het
Piezo2	T	C	18: 63,078,791	I1322V	possibly damaging	Het
Pih1d1	A	G	7: 45,154,527		probably benign	Het
Plekhd1	T	C	12: 80,722,327	S454P	probably damaging	Het
Polr2h	G	A	16: 20,720,553	V89M	probably damaging	Het
Pptc7	G	A	5: 122,284,717	G17S	possibly damaging	Het
Ptpra	T	C	2: 130,544,436	V602A	probably damaging	Het
Rnf123	C	T	9: 108,063,680	R654H	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Samsn1	A	G	16: 75,879,103	S135P	probably damaging	Het
Sgsm3	A	G	15: 81,006,779	N147S	probably benign	Het
Slc22a29	T	C	19: 8,161,569	T510A	probably benign	Het
Smc4	T	A	3: 69,031,811	H978Q	probably damaging	Het
Sox7	G	A	14: 63,948,478	R321H	probably damaging	Het
Spred3	T	C	7: 29,161,833	D307G	probably damaging	Het
Syne2	T	A	12: 75,854,101	D11E	probably benign	Het
Tob1	ACAGCAGCAGCAGCAGCAGCAGCAGCA	ACAGCAGCAGCAGCAGCAGCAGCA	11: 94,214,452		probably benign	Het
Tspan1	T	A	4: 116,163,366	R206*	probably null	Het
Ttc3	A	T	16: 94,429,455	N837I	probably damaging	Het
Vmn1r36	T	C	6: 66,716,565	T72A	possibly damaging	Het
Vmn2r10	A	G	5: 109,003,458	S97P	probably damaging	Het
Zfp2	T	A	11: 50,900,014	I401F	probably damaging	Het
Zfp629	T	C	7: 127,611,018	T540A	possibly damaging	Het
Zfr	G	A	15: 12,166,145	V834I	probably benign	Het

Other mutations in Top2b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00430:Top2b	APN	14	16422692	missense	probably benign	0.00
IGL00730:Top2b	APN	14	16389831	missense	probably damaging	1.00
IGL00917:Top2b	APN	14	16407354	missense	probably benign	0.05
IGL01959:Top2b	APN	14	16422695	missense	probably benign	0.19
IGL02019:Top2b	APN	14	16409965	missense	probably benign	0.44
IGL02119:Top2b	APN	14	16406733	missense	probably damaging	1.00
IGL02136:Top2b	APN	14	16407103	unclassified	probably benign
IGL02148:Top2b	APN	14	16400488	missense	probably damaging	1.00
IGL02496:Top2b	APN	14	16387335	missense	probably benign
IGL02503:Top2b	APN	14	16407163	missense	possibly damaging	0.92
IGL02672:Top2b	APN	14	16409166	unclassified	probably benign
IGL02721:Top2b	APN	14	16409236	missense	probably damaging	1.00
IGL02886:Top2b	APN	14	16365688	missense	possibly damaging	0.73
IGL03252:Top2b	APN	14	16393163	missense	possibly damaging	0.60
PIT4434001:Top2b	UTSW	14	16423780	critical splice donor site	probably null
R0092:Top2b	UTSW	14	16409263	missense	probably damaging	1.00
R0201:Top2b	UTSW	14	16383174	missense	probably damaging	1.00
R0390:Top2b	UTSW	14	16418442	missense	probably benign	0.00
R0394:Top2b	UTSW	14	16413556	splice site	probably null
R1159:Top2b	UTSW	14	16430329	missense	possibly damaging	0.81
R1424:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R1519:Top2b	UTSW	14	16408953	splice site	probably null
R1561:Top2b	UTSW	14	16398993	missense	possibly damaging	0.80
R1713:Top2b	UTSW	14	16409823	missense	probably benign	0.05
R1987:Top2b	UTSW	14	16398916	missense	probably damaging	0.99
R2219:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2287:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2422:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R2679:Top2b	UTSW	14	16413947	missense	probably damaging	1.00
R3687:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3707:Top2b	UTSW	14	16388447	missense	probably damaging	1.00
R3810:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3812:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3815:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3816:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R3818:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4023:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4025:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4026:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4133:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4157:Top2b	UTSW	14	16384491	missense	probably benign	0.42
R4179:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4180:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4300:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4376:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4377:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4492:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4549:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4550:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4581:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4582:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4628:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4630:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4667:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4668:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4669:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R4698:Top2b	UTSW	14	16387331	nonsense	probably null
R4769:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R4809:Top2b	UTSW	14	16383125	missense	probably benign	0.06
R5035:Top2b	UTSW	14	16409966	missense	probably benign	0.01
R5621:Top2b	UTSW	14	16387280	missense	probably damaging	1.00
R5631:Top2b	UTSW	14	16409882	missense	probably damaging	1.00
R5685:Top2b	UTSW	14	16413666	missense	probably damaging	1.00
R5732:Top2b	UTSW	14	16400106	missense	possibly damaging	0.92
R5939:Top2b	UTSW	14	16422786	missense	probably damaging	0.96
R6007:Top2b	UTSW	14	16423779	critical splice donor site	probably null
R6087:Top2b	UTSW	14	16409864	missense	probably benign	0.14
R6144:Top2b	UTSW	14	16423740	missense	possibly damaging	0.48
R6196:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6218:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6229:Top2b	UTSW	14	16409838	missense	probably damaging	1.00
R6249:Top2b	UTSW	14	16399006	missense	probably damaging	1.00
R6337:Top2b	UTSW	14	16399026	missense	possibly damaging	0.77
R6353:Top2b	UTSW	14	16416671	missense	probably damaging	1.00
R6512:Top2b	UTSW	14	16409854	missense	possibly damaging	0.94
R6573:Top2b	UTSW	14	16398991	missense	probably damaging	1.00
R6614:Top2b	UTSW	14	16407142	nonsense	probably null
R6844:Top2b	UTSW	14	16429383	missense	possibly damaging	0.94
R6848:Top2b	UTSW	14	16409958	missense	possibly damaging	0.89
R6871:Top2b	UTSW	14	16409189	missense	probably damaging	1.00
R6895:Top2b	UTSW	14	16413604	missense	probably benign	0.06
R7162:Top2b	UTSW	14	16416653	missense	probably benign	0.00
R7247:Top2b	UTSW	14	16416962	missense	probably benign	0.08
R7250:Top2b	UTSW	14	16420411	missense	probably benign
R7359:Top2b	UTSW	14	16407376	missense	probably null	1.00
R7365:Top2b	UTSW	14	16416649	missense	probably benign	0.04
R7493:Top2b	UTSW	14	16416605	missense	probably benign	0.00
R7528:Top2b	UTSW	14	16395427	nonsense	probably null
R7562:Top2b	UTSW	14	16412946	missense	probably benign	0.04
R7594:Top2b	UTSW	14	16428587	missense	probably benign
R7670:Top2b	UTSW	14	16416620	missense	possibly damaging	0.61
R7894:Top2b	UTSW	14	16413081	missense	possibly damaging	0.68
R8031:Top2b	UTSW	14	16412986	missense	probably damaging	0.98
R8150:Top2b	UTSW	14	16393291	missense	probably damaging	0.99
R8214:Top2b	UTSW	14	16383177	missense	probably damaging	1.00
R8299:Top2b	UTSW	14	16386123	missense	possibly damaging	0.68
R8977:Top2b	UTSW	14	16393239	missense	probably benign	0.36
R9562:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9565:Top2b	UTSW	14	16365718	missense	probably benign	0.09
R9798:Top2b	UTSW	14	16389845	missense	probably damaging	1.00
X0028:Top2b	UTSW	14	16384499	nonsense	probably null
Z1176:Top2b	UTSW	14	16395434	missense	probably damaging	1.00
Z1177:Top2b	UTSW	14	16416953	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CATCAAGCTATGCCATTGTTTTCCAG -3'
(R):5'- CTGTCAGTTAGATTAGAATTCCAGC -3'

Sequencing Primer
(F):5'- AGTTGACACTGACTTACATCTTGCTG -3'
(R):5'- AGCTCCATTCAGACTTTACCTGTAAC -3'

Posted On

2016-03-17