Mutagenetix > Incidental Mutation

Incidental Mutation 'R4899:Ttc3'

376045

Institutional Source

Beutler Lab

Gene Symbol

Ttc3

Ensembl Gene

ENSMUSG00000040785

Gene Name

tetratricopeptide repeat domain 3

Synonyms

2610202A04Rik, D16Ium21, D16Ium21e, TPRD

MMRRC Submission

042503-MU

Accession Numbers

Is this an essential gene?

Possibly essential (E-score: 0.666) question?

Stock #

R4899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

94370618-94469343 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 94429455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 837 (N837I)

Ref Sequence

ENSEMBL: ENSMUSP00000156151 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000117648] [ENSMUST00000122895] [ENSMUST00000143145] [ENSMUST00000147046] [ENSMUST00000147352] [ENSMUST00000150346] [ENSMUST00000151770] [ENSMUST00000152117] [ENSMUST00000153988] [ENSMUST00000155692] [ENSMUST00000231569] [ENSMUST00000232660] [ENSMUST00000232395] [ENSMUST00000231850] [ENSMUST00000231915]

AlphaFold

no structure available at present

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000101881

Predicted Effect

probably damaging
Transcript: ENSMUST00000117648
AA Change: N837I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000112801
Gene: ENSMUSG00000040785
AA Change: N837I

Domain	Start	End	E-Value	Type
TPR	231	264	3.61e-2	SMART
TPR	265	298	3.32e-1	SMART
Blast:TPR	300	332	2e-12	BLAST
low complexity region	444	459	N/A	INTRINSIC
TPR	576	609	2.55e-2	SMART
low complexity region	720	732	N/A	INTRINSIC
coiled coil region	765	796	N/A	INTRINSIC
low complexity region	1018	1032	N/A	INTRINSIC
low complexity region	1036	1050	N/A	INTRINSIC
low complexity region	1170	1190	N/A	INTRINSIC
low complexity region	1248	1260	N/A	INTRINSIC
low complexity region	1278	1291	N/A	INTRINSIC
coiled coil region	1472	1570	N/A	INTRINSIC
low complexity region	1876	1887	N/A	INTRINSIC
RING	1931	1970	7e-9	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000122895
AA Change: N819I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000123037
Gene: ENSMUSG00000040785
AA Change: N819I

Domain	Start	End	E-Value	Type
TPR	213	246	3.61e-2	SMART
TPR	247	280	3.32e-1	SMART
Blast:TPR	282	314	3e-12	BLAST
low complexity region	426	441	N/A	INTRINSIC
TPR	558	591	2.55e-2	SMART
low complexity region	702	714	N/A	INTRINSIC
coiled coil region	747	778	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1018	1032	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141176

SMART Domains

Protein: ENSMUSP00000114483
Gene: ENSMUSG00000040785

Domain	Start	End	E-Value	Type
low complexity region	28	40	N/A	INTRINSIC
coiled coil region	72	103	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000143145

Predicted Effect

probably benign
Transcript: ENSMUST00000147046

SMART Domains

Protein: ENSMUSP00000119265
Gene: ENSMUSG00000040785

Domain	Start	End	E-Value	Type
low complexity region	43	58	N/A	INTRINSIC
Pfam:TPR_1	175	206	5.3e-6	PFAM
low complexity region	319	331	N/A	INTRINSIC
low complexity region	359	382	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000147352
AA Change: N819I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000116097
Gene: ENSMUSG00000040785
AA Change: N819I

Domain	Start	End	E-Value	Type
TPR	213	246	3.61e-2	SMART
TPR	247	280	3.32e-1	SMART
Blast:TPR	282	314	3e-12	BLAST
low complexity region	426	441	N/A	INTRINSIC
TPR	558	591	2.55e-2	SMART
low complexity region	702	714	N/A	INTRINSIC
coiled coil region	747	778	N/A	INTRINSIC
low complexity region	1000	1014	N/A	INTRINSIC
low complexity region	1018	1032	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000150346
AA Change: N436I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000122726
Gene: ENSMUSG00000040785
AA Change: N436I

Domain	Start	End	E-Value	Type
low complexity region	43	58	N/A	INTRINSIC
Pfam:TPR_1	175	206	9.6e-6	PFAM
low complexity region	319	331	N/A	INTRINSIC
coiled coil region	364	395	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000151770
AA Change: N837I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000121349
Gene: ENSMUSG00000040785
AA Change: N837I

Domain	Start	End	E-Value	Type
TPR	231	264	3.61e-2	SMART
TPR	265	298	3.32e-1	SMART
Blast:TPR	300	332	3e-12	BLAST
low complexity region	444	459	N/A	INTRINSIC
TPR	576	609	2.55e-2	SMART
low complexity region	720	732	N/A	INTRINSIC
coiled coil region	765	796	N/A	INTRINSIC
low complexity region	1018	1032	N/A	INTRINSIC
low complexity region	1036	1050	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000152117
AA Change: N436I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000116896
Gene: ENSMUSG00000040785
AA Change: N436I

Domain	Start	End	E-Value	Type
low complexity region	43	58	N/A	INTRINSIC
SCOP:d1ihga1	69	201	6e-8	SMART
Blast:TPR	175	208	1e-14	BLAST
low complexity region	319	331	N/A	INTRINSIC
coiled coil region	364	395	N/A	INTRINSIC
low complexity region	617	631	N/A	INTRINSIC
low complexity region	635	649	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000153988

SMART Domains

Protein: ENSMUSP00000118763
Gene: ENSMUSG00000040785

Domain	Start	End	E-Value	Type
Blast:TPR	1	22	3e-6	BLAST
low complexity region	134	149	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000155692
AA Change: N856I

PolyPhen 2 Score 0.979 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000122724
Gene: ENSMUSG00000040785
AA Change: N856I

Domain	Start	End	E-Value	Type
TPR	250	283	3.61e-2	SMART
TPR	284	317	3.32e-1	SMART
Blast:TPR	319	351	3e-12	BLAST
low complexity region	463	478	N/A	INTRINSIC
TPR	595	628	2.55e-2	SMART
low complexity region	739	751	N/A	INTRINSIC
coiled coil region	784	815	N/A	INTRINSIC
low complexity region	1037	1051	N/A	INTRINSIC
low complexity region	1055	1069	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000231569
AA Change: N482I

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)

Predicted Effect

probably damaging
Transcript: ENSMUST00000232660
AA Change: N837I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably damaging
Transcript: ENSMUST00000232395
AA Change: N837I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

Predicted Effect

probably benign
Transcript: ENSMUST00000231850

Predicted Effect

probably benign
Transcript: ENSMUST00000231915

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010005H15Rik	A	T	16: 36,257,365	Y96F	possibly damaging	Het
9230110C19Rik	A	T	9: 8,022,493	S243T	possibly damaging	Het
Abhd18	C	G	3: 40,905,869		probably null	Het
Adra2c	A	T	5: 35,280,361	Y159F	probably damaging	Het
AI481877	T	C	4: 59,062,640	Y872C	probably damaging	Het
Alkal2	T	A	12: 30,884,973	S64T	probably benign	Het
Apbb1ip	T	C	2: 22,823,349	V72A	unknown	Het
Atp13a5	A	G	16: 29,378,500	L13P	probably damaging	Het
Azin2	G	A	4: 128,934,653	P254S	probably benign	Het
Bmpr1b	T	C	3: 141,840,683	R481G	probably damaging	Het
Cacna2d4	G	A	6: 119,268,196	W288*	probably null	Het
Cass4	A	G	2: 172,427,869	T626A	probably benign	Het
Cep112	T	A	11: 108,606,284	D683E	probably damaging	Het
Chat	G	T	14: 32,448,977	S188R	possibly damaging	Het
Cit	A	G	5: 115,863,028	Y162C	possibly damaging	Het
Clca3a1	T	A	3: 144,737,961	Y676F	probably damaging	Het
Clec2h	A	G	6: 128,675,824	N185D	probably benign	Het
Cnbd2	G	T	2: 156,339,221	V192F	probably benign	Het
Col6a3	C	A	1: 90,802,427	G1112V	probably damaging	Het
Cyp3a25	A	G	5: 145,977,671	F483S	possibly damaging	Het
Dscam	T	C	16: 96,683,818	E1103G	probably benign	Het
Dync2h1	G	A	9: 7,131,921	Q1629*	probably null	Het
E330014E10Rik	T	C	5: 95,801,727	V111A	probably benign	Het
Enpp6	A	G	8: 46,987,083	Y38C	probably damaging	Het
Epg5	T	A	18: 77,985,057	L1271Q	probably damaging	Het
Fam47e	G	A	5: 92,574,669	V75I	probably benign	Het
Fat3	T	C	9: 15,969,799	D3259G	probably damaging	Het
Fbxw28	T	C	9: 109,330,853	D211G	probably damaging	Het
Flnc	A	G	6: 29,446,843	N990D	probably benign	Het
Frat1	T	G	19: 41,830,322	L52R	probably damaging	Het
Ftmt	C	G	18: 52,331,586		probably benign	Het
H2-M1	C	T	17: 36,671,220	G163D	probably benign	Het
Hapln1	A	G	13: 89,601,650	K105E	possibly damaging	Het
Igkv17-127	G	T	6: 67,861,397	A31S	probably benign	Het
Il6st	T	C	13: 112,501,161	L628P	probably damaging	Het
Kcnj6	A	G	16: 94,832,613	I213T	probably damaging	Het
Kidins220	T	C	12: 25,013,443		probably null	Het
Lama2	TTTGCGCATT	TTT	10: 27,043,643		probably null	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Marc2	A	T	1: 184,845,624	I65N	probably damaging	Het
Mertk	C	A	2: 128,783,925	P660Q	probably damaging	Het
Mkl1	A	G	15: 81,018,386	Y241H	probably damaging	Het
Napepld	A	G	5: 21,683,440	Y4H	probably benign	Het
Ncam1	T	A	9: 49,545,251		probably null	Het
Nuak2	A	T	1: 132,324,986	K93*	probably null	Het
Oat	A	T	7: 132,564,222	D211E	probably benign	Het
Olfr1214	A	C	2: 88,988,110	L31V	probably null	Het
Olfr1355	A	T	10: 78,879,207	S12C	probably benign	Het
Olfr171	G	A	16: 19,624,200	A300V	probably benign	Het
Olfr348	A	G	2: 36,786,798	Q91R	probably benign	Het
Olfr64	A	G	7: 103,893,465	I90T	possibly damaging	Het
Pde4dip	C	A	3: 97,709,558	K1789N	probably damaging	Het
Piezo2	T	C	18: 63,078,791	I1322V	possibly damaging	Het
Pih1d1	A	G	7: 45,154,527		probably benign	Het
Plekhd1	T	C	12: 80,722,327	S454P	probably damaging	Het
Polr2h	G	A	16: 20,720,553	V89M	probably damaging	Het
Pptc7	G	A	5: 122,284,717	G17S	possibly damaging	Het
Ptpra	T	C	2: 130,544,436	V602A	probably damaging	Het
Rnf123	C	T	9: 108,063,680	R654H	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Samsn1	A	G	16: 75,879,103	S135P	probably damaging	Het
Sgsm3	A	G	15: 81,006,779	N147S	probably benign	Het
Slc22a29	T	C	19: 8,161,569	T510A	probably benign	Het
Smc4	T	A	3: 69,031,811	H978Q	probably damaging	Het
Sox7	G	A	14: 63,948,478	R321H	probably damaging	Het
Spred3	T	C	7: 29,161,833	D307G	probably damaging	Het
Syne2	T	A	12: 75,854,101	D11E	probably benign	Het
Tob1	ACAGCAGCAGCAGCAGCAGCAGCAGCA	ACAGCAGCAGCAGCAGCAGCAGCA	11: 94,214,452		probably benign	Het
Top2b	A	T	14: 16,387,313	I134F	probably damaging	Het
Tspan1	T	A	4: 116,163,366	R206*	probably null	Het
Vmn1r36	T	C	6: 66,716,565	T72A	possibly damaging	Het
Vmn2r10	A	G	5: 109,003,458	S97P	probably damaging	Het
Zfp2	T	A	11: 50,900,014	I401F	probably damaging	Het
Zfp629	T	C	7: 127,611,018	T540A	possibly damaging	Het
Zfr	G	A	15: 12,166,145	V834I	probably benign	Het

Other mutations in Ttc3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00944:Ttc3	APN	16	94426761	splice site	probably null
IGL00979:Ttc3	APN	16	94456718	missense	probably damaging	1.00
IGL01520:Ttc3	APN	16	94390207	missense	probably benign	0.04
IGL01663:Ttc3	APN	16	94409731	critical splice donor site	probably null
IGL01720:Ttc3	APN	16	94385369	missense	probably damaging	0.99
IGL01736:Ttc3	APN	16	94442527	missense	probably damaging	0.99
IGL02045:Ttc3	APN	16	94409681	splice site	probably benign
IGL02203:Ttc3	APN	16	94418598	splice site	probably benign
IGL02327:Ttc3	APN	16	94448108	missense	probably damaging	1.00
IGL02794:Ttc3	APN	16	94467926	missense	probably damaging	1.00
IGL02898:Ttc3	APN	16	94419426	missense	probably damaging	1.00
PIT4378001:Ttc3	UTSW	16	94410906	missense	probably benign	0.01
R0064:Ttc3	UTSW	16	94422247	missense	possibly damaging	0.79
R0098:Ttc3	UTSW	16	94390265	missense	probably benign	0.02
R0112:Ttc3	UTSW	16	94385322	splice site	probably benign
R0135:Ttc3	UTSW	16	94462268	missense	possibly damaging	0.92
R0480:Ttc3	UTSW	16	94432004	nonsense	probably null
R0513:Ttc3	UTSW	16	94426212	missense	probably damaging	1.00
R0532:Ttc3	UTSW	16	94387330	splice site	probably benign
R0607:Ttc3	UTSW	16	94456785	nonsense	probably null
R0742:Ttc3	UTSW	16	94459880	missense	probably benign	0.23
R0905:Ttc3	UTSW	16	94456789	nonsense	probably null
R1118:Ttc3	UTSW	16	94416268	splice site	probably benign
R1355:Ttc3	UTSW	16	94418637	missense	possibly damaging	0.46
R1370:Ttc3	UTSW	16	94418637	missense	possibly damaging	0.46
R1486:Ttc3	UTSW	16	94448129	missense	probably damaging	1.00
R1598:Ttc3	UTSW	16	94422297	missense	probably damaging	1.00
R1641:Ttc3	UTSW	16	94443317	missense	probably benign	0.19
R2092:Ttc3	UTSW	16	94442832	missense	probably benign	0.02
R2232:Ttc3	UTSW	16	94459972	missense	probably benign	0.00
R2339:Ttc3	UTSW	16	94431998	missense	probably damaging	1.00
R2342:Ttc3	UTSW	16	94431998	missense	probably damaging	1.00
R2842:Ttc3	UTSW	16	94431998	missense	probably damaging	1.00
R3117:Ttc3	UTSW	16	94442563	missense	possibly damaging	0.51
R4194:Ttc3	UTSW	16	94422277	missense	probably damaging	0.99
R4329:Ttc3	UTSW	16	94466961	missense	probably damaging	1.00
R4431:Ttc3	UTSW	16	94410958	critical splice donor site	probably null
R4530:Ttc3	UTSW	16	94466877	intron	probably benign
R4531:Ttc3	UTSW	16	94466877	intron	probably benign
R4532:Ttc3	UTSW	16	94466877	intron	probably benign
R4533:Ttc3	UTSW	16	94466877	intron	probably benign
R4588:Ttc3	UTSW	16	94442901	missense	probably benign	0.01
R4625:Ttc3	UTSW	16	94388272	nonsense	probably null
R4676:Ttc3	UTSW	16	94442761	missense	probably damaging	1.00
R4700:Ttc3	UTSW	16	94439241	splice site	probably null
R4856:Ttc3	UTSW	16	94390283	missense	probably benign	0.32
R4867:Ttc3	UTSW	16	94454515	missense	probably damaging	0.96
R4885:Ttc3	UTSW	16	94419465	missense	probably damaging	1.00
R4885:Ttc3	UTSW	16	94426831	critical splice donor site	probably null
R4997:Ttc3	UTSW	16	94452982	missense	probably damaging	1.00
R5023:Ttc3	UTSW	16	94429359	missense	probably benign	0.01
R5105:Ttc3	UTSW	16	94466934	missense	possibly damaging	0.94
R5205:Ttc3	UTSW	16	94448059	missense	probably benign	0.07
R5287:Ttc3	UTSW	16	94459844	missense	probably benign	0.00
R5338:Ttc3	UTSW	16	94384041	missense	probably damaging	0.99
R5347:Ttc3	UTSW	16	94429620	missense	probably damaging	1.00
R5403:Ttc3	UTSW	16	94459844	missense	probably benign	0.00
R5460:Ttc3	UTSW	16	94457382	missense	probably benign	0.32
R5739:Ttc3	UTSW	16	94439324	nonsense	probably null
R6242:Ttc3	UTSW	16	94442695	missense	probably benign	0.04
R6253:Ttc3	UTSW	16	94457413	critical splice donor site	probably null
R6455:Ttc3	UTSW	16	94418623	start codon destroyed	probably null	0.83
R6559:Ttc3	UTSW	16	94422349	critical splice donor site	probably null
R6564:Ttc3	UTSW	16	94442611	missense	probably damaging	1.00
R6932:Ttc3	UTSW	16	94443453	missense	probably benign
R7331:Ttc3	UTSW	16	94394359	missense	probably benign	0.27
R7497:Ttc3	UTSW	16	94418682	missense	possibly damaging	0.93
R7610:Ttc3	UTSW	16	94427838	missense	probably benign	0.11
R7738:Ttc3	UTSW	16	94387382	missense	probably benign	0.00
R7970:Ttc3	UTSW	16	94457364	missense	probably damaging	1.00
R8052:Ttc3	UTSW	16	94467989	missense	probably benign	0.09
R8087:Ttc3	UTSW	16	94442953	missense	probably benign	0.00
R8309:Ttc3	UTSW	16	94466979	missense	probably damaging	1.00
R8320:Ttc3	UTSW	16	94418676	missense	probably damaging	1.00
R8322:Ttc3	UTSW	16	94454492	missense	probably damaging	1.00
R8518:Ttc3	UTSW	16	94457379	missense	probably benign	0.21
R8670:Ttc3	UTSW	16	94390208	missense	probably damaging	0.99
R8826:Ttc3	UTSW	16	94431970	missense	possibly damaging	0.85
R8868:Ttc3	UTSW	16	94451143	missense	probably benign	0.00
R8873:Ttc3	UTSW	16	94442983	missense	probably damaging	0.97
R8940:Ttc3	UTSW	16	94429499	missense	possibly damaging	0.94
R8993:Ttc3	UTSW	16	94427808	missense	possibly damaging	0.85
R9068:Ttc3	UTSW	16	94403360	missense	probably damaging	1.00
R9119:Ttc3	UTSW	16	94392091	missense	probably damaging	0.98
R9124:Ttc3	UTSW	16	94435530	missense	probably benign	0.00
R9129:Ttc3	UTSW	16	94384349	missense	probably benign	0.02
R9189:Ttc3	UTSW	16	94467972	missense	possibly damaging	0.62
R9217:Ttc3	UTSW	16	94429608	missense	possibly damaging	0.80
R9490:Ttc3	UTSW	16	94444501	missense	probably benign
R9564:Ttc3	UTSW	16	94448059	missense	probably benign	0.07
X0022:Ttc3	UTSW	16	94442525	missense	probably benign	0.00
Y5378:Ttc3	UTSW	16	94412129	splice site	probably null

Predicted Primers

PCR Primer
(F):5'- ACAGAAAGCAGCCATGTTTATG -3'
(R):5'- GCCAACTTGGGGTCTAACTC -3'

Sequencing Primer
(F):5'- AAGCAGCCATGTTTATGTTACTGTGC -3'
(R):5'- GCCAACTTGGGGTCTAACTCTTTAAG -3'

Posted On

2016-03-17