Incidental Mutation 'R4899:Kcnj6'
ID376046
Institutional Source Beutler Lab
Gene Symbol Kcnj6
Ensembl Gene ENSMUSG00000043301
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 6
SynonymsKCNJ7, GIRK2, Kir3.2
MMRRC Submission 042503-MU
Accession Numbers

Genbank: NM_001025584.2, NM_001025585.2, NM_001025590.1, NM_010606.2  

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4899 (G1)
Quality Score225
Status Not validated
Chromosome16
Chromosomal Location94748636-94997701 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 94832613 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 213 (I213T)
Ref Sequence ENSEMBL: ENSMUSP00000093558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095873] [ENSMUST00000099508] [ENSMUST00000165538] [ENSMUST00000232562]
PDB Structure
Crystal Structure of the Cytoplasmic Domain of G-Protein-Gated Inward Rectifier Potassium Channel Kir3.2 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000095873
AA Change: I213T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000093558
Gene: ENSMUSG00000043301
AA Change: I213T

DomainStartEndE-ValueType
Pfam:IRK 59 397 9.3e-166 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099508
AA Change: I213T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097108
Gene: ENSMUSG00000043301
AA Change: I213T

DomainStartEndE-ValueType
Pfam:IRK 59 382 8.5e-146 PFAM
low complexity region 396 411 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165538
AA Change: I195T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000130321
Gene: ENSMUSG00000043301
AA Change: I195T

DomainStartEndE-ValueType
Pfam:IRK 41 302 5.3e-122 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000232403
Predicted Effect probably damaging
Transcript: ENSMUST00000232562
AA Change: I195T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the G protein-coupled inwardly-rectifying potassium channel family of inward rectifier potassium channels. This type of potassium channel allows a greater flow of potassium into the cell than out of it. These proteins modulate many physiological processes, including heart rate in cardiac cells and circuit activity in neuronal cells, through G-protein coupled receptor stimulation. Mutations in this gene are associated with Keppen-Lubinsky Syndrome, a rare condition characterized by severe developmental delay, facial dysmorphism, and intellectual disability. [provided by RefSeq, Apr 2015]
PHENOTYPE: A spontaneous mutation exhibits small size, ataxia, hypotonia, high periweaning mortality, Purkinje cell defects, and male sterility. Homozygotes for a targeted null mutation exhibit increased susceptibility to spontaneous and drug-induced seizures. [provided by MGI curators]
Allele List at MGI

All alleles(3) : Targeted, knock-out(1) Gene trapped(1) Spontaneous(1)

Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A T 16: 36,257,365 Y96F possibly damaging Het
9230110C19Rik A T 9: 8,022,493 S243T possibly damaging Het
Abhd18 C G 3: 40,905,869 probably null Het
Adra2c A T 5: 35,280,361 Y159F probably damaging Het
AI481877 T C 4: 59,062,640 Y872C probably damaging Het
Alkal2 T A 12: 30,884,973 S64T probably benign Het
Apbb1ip T C 2: 22,823,349 V72A unknown Het
Atp13a5 A G 16: 29,378,500 L13P probably damaging Het
Azin2 G A 4: 128,934,653 P254S probably benign Het
Bmpr1b T C 3: 141,840,683 R481G probably damaging Het
Cacna2d4 G A 6: 119,268,196 W288* probably null Het
Cass4 A G 2: 172,427,869 T626A probably benign Het
Cep112 T A 11: 108,606,284 D683E probably damaging Het
Chat G T 14: 32,448,977 S188R possibly damaging Het
Cit A G 5: 115,863,028 Y162C possibly damaging Het
Clca3a1 T A 3: 144,737,961 Y676F probably damaging Het
Clec2h A G 6: 128,675,824 N185D probably benign Het
Cnbd2 G T 2: 156,339,221 V192F probably benign Het
Col6a3 C A 1: 90,802,427 G1112V probably damaging Het
Cyp3a25 A G 5: 145,977,671 F483S possibly damaging Het
Dscam T C 16: 96,683,818 E1103G probably benign Het
Dync2h1 G A 9: 7,131,921 Q1629* probably null Het
E330014E10Rik T C 5: 95,801,727 V111A probably benign Het
Enpp6 A G 8: 46,987,083 Y38C probably damaging Het
Epg5 T A 18: 77,985,057 L1271Q probably damaging Het
Fam47e G A 5: 92,574,669 V75I probably benign Het
Fat3 T C 9: 15,969,799 D3259G probably damaging Het
Fbxw28 T C 9: 109,330,853 D211G probably damaging Het
Flnc A G 6: 29,446,843 N990D probably benign Het
Frat1 T G 19: 41,830,322 L52R probably damaging Het
Ftmt C G 18: 52,331,586 probably benign Het
H2-M1 C T 17: 36,671,220 G163D probably benign Het
Hapln1 A G 13: 89,601,650 K105E possibly damaging Het
Igkv17-127 G T 6: 67,861,397 A31S probably benign Het
Il6st T C 13: 112,501,161 L628P probably damaging Het
Kidins220 T C 12: 25,013,443 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Marc2 A T 1: 184,845,624 I65N probably damaging Het
Mertk C A 2: 128,783,925 P660Q probably damaging Het
Mkl1 A G 15: 81,018,386 Y241H probably damaging Het
Napepld A G 5: 21,683,440 Y4H probably benign Het
Ncam1 T A 9: 49,545,251 probably null Het
Nuak2 A T 1: 132,324,986 K93* probably null Het
Oat A T 7: 132,564,222 D211E probably benign Het
Olfr1214 A C 2: 88,988,110 L31V probably null Het
Olfr1355 A T 10: 78,879,207 S12C probably benign Het
Olfr171 G A 16: 19,624,200 A300V probably benign Het
Olfr348 A G 2: 36,786,798 Q91R probably benign Het
Olfr64 A G 7: 103,893,465 I90T possibly damaging Het
Pde4dip C A 3: 97,709,558 K1789N probably damaging Het
Piezo2 T C 18: 63,078,791 I1322V possibly damaging Het
Pih1d1 A G 7: 45,154,527 probably benign Het
Plekhd1 T C 12: 80,722,327 S454P probably damaging Het
Polr2h G A 16: 20,720,553 V89M probably damaging Het
Pptc7 G A 5: 122,284,717 G17S possibly damaging Het
Ptpra T C 2: 130,544,436 V602A probably damaging Het
Rnf123 C T 9: 108,063,680 R654H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 A G 16: 75,879,103 S135P probably damaging Het
Sgsm3 A G 15: 81,006,779 N147S probably benign Het
Slc22a29 T C 19: 8,161,569 T510A probably benign Het
Smc4 T A 3: 69,031,811 H978Q probably damaging Het
Sox7 G A 14: 63,948,478 R321H probably damaging Het
Spred3 T C 7: 29,161,833 D307G probably damaging Het
Syne2 T A 12: 75,854,101 D11E probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Top2b A T 14: 16,387,313 I134F probably damaging Het
Tspan1 T A 4: 116,163,366 R206* probably null Het
Ttc3 A T 16: 94,429,455 N837I probably damaging Het
Vmn1r36 T C 6: 66,716,565 T72A possibly damaging Het
Vmn2r10 A G 5: 109,003,458 S97P probably damaging Het
Zfp2 T A 11: 50,900,014 I401F probably damaging Het
Zfp629 T C 7: 127,611,018 T540A possibly damaging Het
Zfr G A 15: 12,166,145 V834I probably benign Het
Other mutations in Kcnj6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01309:Kcnj6 APN 16 94832455 missense probably damaging 0.99
IGL01433:Kcnj6 APN 16 94832955 missense probably benign 0.21
IGL01603:Kcnj6 APN 16 94833199 missense probably benign 0.00
IGL02212:Kcnj6 APN 16 94832487 missense probably damaging 1.00
IGL02982:Kcnj6 APN 16 94832517 missense possibly damaging 0.89
IGL03351:Kcnj6 APN 16 94832583 missense probably damaging 1.00
Seizure UTSW 16 94832659 missense probably damaging 1.00
H8477:Kcnj6 UTSW 16 94832937 missense probably damaging 1.00
IGL02796:Kcnj6 UTSW 16 94832919 missense probably benign 0.00
R0070:Kcnj6 UTSW 16 94941197 missense probably benign
R1558:Kcnj6 UTSW 16 94762499 missense possibly damaging 0.57
R1676:Kcnj6 UTSW 16 94832584 missense probably damaging 1.00
R2435:Kcnj6 UTSW 16 94762679 missense probably damaging 0.99
R3700:Kcnj6 UTSW 16 94833006 missense probably damaging 0.96
R3800:Kcnj6 UTSW 16 94833027 missense probably damaging 1.00
R4012:Kcnj6 UTSW 16 94825018 splice site probably null
R5124:Kcnj6 UTSW 16 94832659 missense probably damaging 1.00
R5359:Kcnj6 UTSW 16 94832453 nonsense probably null
R5560:Kcnj6 UTSW 16 94832965 missense probably benign 0.06
R5583:Kcnj6 UTSW 16 94833201 missense probably benign 0.26
R6057:Kcnj6 UTSW 16 94832377 missense probably damaging 1.00
R6330:Kcnj6 UTSW 16 94762601 missense possibly damaging 0.93
R6582:Kcnj6 UTSW 16 94832826 missense possibly damaging 0.93
R6604:Kcnj6 UTSW 16 94762645 missense probably damaging 1.00
R6802:Kcnj6 UTSW 16 94762577 missense probably benign 0.06
R6866:Kcnj6 UTSW 16 94762677 missense probably damaging 1.00
R7304:Kcnj6 UTSW 16 94941183 missense probably benign
R7337:Kcnj6 UTSW 16 94833214 missense probably benign 0.10
R7396:Kcnj6 UTSW 16 94762447 missense probably benign 0.31
Predicted Primers PCR Primer
(F):5'- CTGTGTAGTACCCCACGTTG -3'
(R):5'- CACCAACCTCAACGGGTTTG -3'

Sequencing Primer
(F):5'- GTGTAGTACCCCACGTTGATATCAG -3'
(R):5'- AACCTCAACGGGTTTGTCTCTG -3'
Posted On2016-03-17