Incidental Mutation 'R4899:Piezo2'
ID 376051
Institutional Source Beutler Lab
Gene Symbol Piezo2
Ensembl Gene ENSMUSG00000041482
Gene Name piezo-type mechanosensitive ion channel component 2
Synonyms Fam38b, Fam38b2, 9030411M15Rik, Piezo2, 9430028L06Rik
MMRRC Submission 042503-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4899 (G1)
Quality Score 225
Status Not validated
Chromosome 18
Chromosomal Location 63010213-63387183 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 63078791 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 1322 (I1322V)
Ref Sequence ENSEMBL: ENSMUSP00000040019 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047480] [ENSMUST00000182233] [ENSMUST00000183217]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000047480
AA Change: I1322V

PolyPhen 2 Score 0.844 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000040019
Gene: ENSMUSG00000041482
AA Change: I1322V

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
internal_repeat_1 740 764 6.01e-5 PROSPERO
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 900 921 N/A INTRINSIC
transmembrane domain 949 971 N/A INTRINSIC
transmembrane domain 976 993 N/A INTRINSIC
transmembrane domain 1000 1022 N/A INTRINSIC
transmembrane domain 1069 1091 N/A INTRINSIC
transmembrane domain 1130 1152 N/A INTRINSIC
transmembrane domain 1156 1173 N/A INTRINSIC
transmembrane domain 1186 1208 N/A INTRINSIC
transmembrane domain 1234 1256 N/A INTRINSIC
transmembrane domain 1308 1327 N/A INTRINSIC
transmembrane domain 1331 1353 N/A INTRINSIC
Pfam:PIEZO 1383 1617 1.1e-105 PFAM
low complexity region 1807 1823 N/A INTRINSIC
low complexity region 1836 1860 N/A INTRINSIC
low complexity region 1863 1878 N/A INTRINSIC
transmembrane domain 1981 2003 N/A INTRINSIC
transmembrane domain 2010 2027 N/A INTRINSIC
internal_repeat_1 2036 2060 6.01e-5 PROSPERO
low complexity region 2167 2199 N/A INTRINSIC
transmembrane domain 2261 2283 N/A INTRINSIC
transmembrane domain 2303 2325 N/A INTRINSIC
transmembrane domain 2332 2354 N/A INTRINSIC
transmembrane domain 2364 2386 N/A INTRINSIC
Pfam:Piezo_RRas_bdg 2412 2821 2.8e-161 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000182233
SMART Domains Protein: ENSMUSP00000138170
Gene: ENSMUSG00000041482

DomainStartEndE-ValueType
transmembrane domain 5 27 N/A INTRINSIC
transmembrane domain 34 56 N/A INTRINSIC
coiled coil region 223 250 N/A INTRINSIC
transmembrane domain 272 294 N/A INTRINSIC
transmembrane domain 307 329 N/A INTRINSIC
SCOP:d1eq1a_ 365 434 1e-3 SMART
transmembrane domain 450 472 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
transmembrane domain 505 527 N/A INTRINSIC
low complexity region 540 552 N/A INTRINSIC
transmembrane domain 559 581 N/A INTRINSIC
low complexity region 668 689 N/A INTRINSIC
transmembrane domain 717 739 N/A INTRINSIC
transmembrane domain 744 761 N/A INTRINSIC
transmembrane domain 768 790 N/A INTRINSIC
transmembrane domain 837 859 N/A INTRINSIC
transmembrane domain 898 920 N/A INTRINSIC
transmembrane domain 924 941 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000183217
AA Change: I1308V

PolyPhen 2 Score 0.834 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138758
Gene: ENSMUSG00000041482
AA Change: I1308V

DomainStartEndE-ValueType
transmembrane domain 13 44 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
low complexity region 179 194 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 241 260 N/A INTRINSIC
transmembrane domain 267 289 N/A INTRINSIC
coiled coil region 455 482 N/A INTRINSIC
transmembrane domain 504 526 N/A INTRINSIC
transmembrane domain 539 561 N/A INTRINSIC
SCOP:d1eq1a_ 597 666 4e-3 SMART
transmembrane domain 682 704 N/A INTRINSIC
transmembrane domain 708 730 N/A INTRINSIC
transmembrane domain 737 759 N/A INTRINSIC
low complexity region 772 784 N/A INTRINSIC
transmembrane domain 791 813 N/A INTRINSIC
low complexity region 886 907 N/A INTRINSIC
transmembrane domain 935 957 N/A INTRINSIC
transmembrane domain 962 979 N/A INTRINSIC
transmembrane domain 986 1008 N/A INTRINSIC
transmembrane domain 1055 1077 N/A INTRINSIC
transmembrane domain 1116 1138 N/A INTRINSIC
transmembrane domain 1142 1159 N/A INTRINSIC
transmembrane domain 1172 1194 N/A INTRINSIC
transmembrane domain 1220 1242 N/A INTRINSIC
transmembrane domain 1294 1313 N/A INTRINSIC
transmembrane domain 1317 1339 N/A INTRINSIC
transmembrane domain 1352 1374 N/A INTRINSIC
coiled coil region 1460 1501 N/A INTRINSIC
low complexity region 1528 1537 N/A INTRINSIC
low complexity region 1558 1575 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains more than thirty transmembrane domains and likely functions as part of mechanically-activated (MA) cation channels. These channels serve to connect mechanical forces to biological signals. The encoded protein quickly adapts MA currents in somatosensory neurons. Defects in this gene are a cause of type 5 distal arthrogryposis. Several alternatively spliced transcript variants of this gene have been described, but their full-length nature is not known. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 75 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2010005H15Rik A T 16: 36,257,365 Y96F possibly damaging Het
9230110C19Rik A T 9: 8,022,493 S243T possibly damaging Het
Abhd18 C G 3: 40,905,869 probably null Het
Adra2c A T 5: 35,280,361 Y159F probably damaging Het
AI481877 T C 4: 59,062,640 Y872C probably damaging Het
Alkal2 T A 12: 30,884,973 S64T probably benign Het
Apbb1ip T C 2: 22,823,349 V72A unknown Het
Atp13a5 A G 16: 29,378,500 L13P probably damaging Het
Azin2 G A 4: 128,934,653 P254S probably benign Het
Bmpr1b T C 3: 141,840,683 R481G probably damaging Het
Cacna2d4 G A 6: 119,268,196 W288* probably null Het
Cass4 A G 2: 172,427,869 T626A probably benign Het
Cep112 T A 11: 108,606,284 D683E probably damaging Het
Chat G T 14: 32,448,977 S188R possibly damaging Het
Cit A G 5: 115,863,028 Y162C possibly damaging Het
Clca3a1 T A 3: 144,737,961 Y676F probably damaging Het
Clec2h A G 6: 128,675,824 N185D probably benign Het
Cnbd2 G T 2: 156,339,221 V192F probably benign Het
Col6a3 C A 1: 90,802,427 G1112V probably damaging Het
Cyp3a25 A G 5: 145,977,671 F483S possibly damaging Het
Dscam T C 16: 96,683,818 E1103G probably benign Het
Dync2h1 G A 9: 7,131,921 Q1629* probably null Het
E330014E10Rik T C 5: 95,801,727 V111A probably benign Het
Enpp6 A G 8: 46,987,083 Y38C probably damaging Het
Epg5 T A 18: 77,985,057 L1271Q probably damaging Het
Fam47e G A 5: 92,574,669 V75I probably benign Het
Fat3 T C 9: 15,969,799 D3259G probably damaging Het
Fbxw28 T C 9: 109,330,853 D211G probably damaging Het
Flnc A G 6: 29,446,843 N990D probably benign Het
Frat1 T G 19: 41,830,322 L52R probably damaging Het
Ftmt C G 18: 52,331,586 probably benign Het
H2-M1 C T 17: 36,671,220 G163D probably benign Het
Hapln1 A G 13: 89,601,650 K105E possibly damaging Het
Igkv17-127 G T 6: 67,861,397 A31S probably benign Het
Il6st T C 13: 112,501,161 L628P probably damaging Het
Kcnj6 A G 16: 94,832,613 I213T probably damaging Het
Kidins220 T C 12: 25,013,443 probably null Het
Lama2 TTTGCGCATT TTT 10: 27,043,643 probably null Het
Llgl1 C T 11: 60,709,568 P581L probably benign Het
Marc2 A T 1: 184,845,624 I65N probably damaging Het
Mertk C A 2: 128,783,925 P660Q probably damaging Het
Mkl1 A G 15: 81,018,386 Y241H probably damaging Het
Napepld A G 5: 21,683,440 Y4H probably benign Het
Ncam1 T A 9: 49,545,251 probably null Het
Nuak2 A T 1: 132,324,986 K93* probably null Het
Oat A T 7: 132,564,222 D211E probably benign Het
Olfr1214 A C 2: 88,988,110 L31V probably null Het
Olfr1355 A T 10: 78,879,207 S12C probably benign Het
Olfr171 G A 16: 19,624,200 A300V probably benign Het
Olfr348 A G 2: 36,786,798 Q91R probably benign Het
Olfr64 A G 7: 103,893,465 I90T possibly damaging Het
Pde4dip C A 3: 97,709,558 K1789N probably damaging Het
Pih1d1 A G 7: 45,154,527 probably benign Het
Plekhd1 T C 12: 80,722,327 S454P probably damaging Het
Polr2h G A 16: 20,720,553 V89M probably damaging Het
Pptc7 G A 5: 122,284,717 G17S possibly damaging Het
Ptpra T C 2: 130,544,436 V602A probably damaging Het
Rnf123 C T 9: 108,063,680 R654H probably damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Samsn1 A G 16: 75,879,103 S135P probably damaging Het
Sgsm3 A G 15: 81,006,779 N147S probably benign Het
Slc22a29 T C 19: 8,161,569 T510A probably benign Het
Smc4 T A 3: 69,031,811 H978Q probably damaging Het
Sox7 G A 14: 63,948,478 R321H probably damaging Het
Spred3 T C 7: 29,161,833 D307G probably damaging Het
Syne2 T A 12: 75,854,101 D11E probably benign Het
Tob1 ACAGCAGCAGCAGCAGCAGCAGCAGCA ACAGCAGCAGCAGCAGCAGCAGCA 11: 94,214,452 probably benign Het
Top2b A T 14: 16,387,313 I134F probably damaging Het
Tspan1 T A 4: 116,163,366 R206* probably null Het
Ttc3 A T 16: 94,429,455 N837I probably damaging Het
Vmn1r36 T C 6: 66,716,565 T72A possibly damaging Het
Vmn2r10 A G 5: 109,003,458 S97P probably damaging Het
Zfp2 T A 11: 50,900,014 I401F probably damaging Het
Zfp629 T C 7: 127,611,018 T540A possibly damaging Het
Zfr G A 15: 12,166,145 V834I probably benign Het
Other mutations in Piezo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Piezo2 APN 18 63117699 missense probably damaging 1.00
IGL01370:Piezo2 APN 18 63022460 missense probably damaging 1.00
IGL01543:Piezo2 APN 18 63070030 missense probably damaging 1.00
IGL01561:Piezo2 APN 18 63124614 missense probably benign 0.03
IGL01568:Piezo2 APN 18 63030392 missense probably benign 0.28
IGL01653:Piezo2 APN 18 63182833 splice site probably benign
IGL01674:Piezo2 APN 18 63027559 missense probably damaging 1.00
IGL01684:Piezo2 APN 18 63083170 missense probably damaging 1.00
IGL01744:Piezo2 APN 18 63042788 missense probably damaging 1.00
IGL01859:Piezo2 APN 18 63092844 missense probably benign 0.10
IGL02183:Piezo2 APN 18 63020634 missense probably benign 0.00
IGL02407:Piezo2 APN 18 63146844 missense probably damaging 1.00
IGL02441:Piezo2 APN 18 63072862 missense probably damaging 1.00
IGL02542:Piezo2 APN 18 63032924 missense probably damaging 0.96
IGL02652:Piezo2 APN 18 63024475 missense probably damaging 1.00
IGL02710:Piezo2 APN 18 63074659 missense probably damaging 1.00
IGL02850:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02851:Piezo2 APN 18 63020633 missense probably benign 0.18
IGL02972:Piezo2 APN 18 63064785 splice site probably benign
IGL03011:Piezo2 APN 18 63124660 missense probably benign 0.03
IGL03078:Piezo2 APN 18 63070075 missense probably damaging 1.00
IGL03114:Piezo2 APN 18 63030272 splice site probably null
IGL03129:Piezo2 APN 18 63114972 missense probably benign
IGL03143:Piezo2 APN 18 63108076 missense probably damaging 0.99
IGL03202:Piezo2 APN 18 63011598 missense probably damaging 1.00
IGL03227:Piezo2 APN 18 63124606 missense probably damaging 1.00
IGL03228:Piezo2 APN 18 63053062 missense probably damaging 1.00
IGL03230:Piezo2 APN 18 63041720 missense probably damaging 1.00
IGL03242:Piezo2 APN 18 63011538 utr 3 prime probably benign
IGL03291:Piezo2 APN 18 63021308 missense probably damaging 1.00
IGL03301:Piezo2 APN 18 63027704 missense probably damaging 1.00
Piccolo UTSW 18 63011696 missense probably damaging 1.00
sopranino UTSW 18 63024466 missense probably damaging 1.00
woodwind UTSW 18 63124642 missense possibly damaging 0.50
P0023:Piezo2 UTSW 18 63386200 splice site probably benign
PIT4802001:Piezo2 UTSW 18 63024469 missense probably damaging 1.00
R0070:Piezo2 UTSW 18 63102084 missense probably damaging 1.00
R0416:Piezo2 UTSW 18 63024491 missense probably damaging 1.00
R0486:Piezo2 UTSW 18 63029061 missense probably damaging 1.00
R0498:Piezo2 UTSW 18 63102174 missense possibly damaging 0.87
R0504:Piezo2 UTSW 18 63024451 missense probably damaging 1.00
R0506:Piezo2 UTSW 18 63027544 missense probably damaging 1.00
R0523:Piezo2 UTSW 18 63022481 missense probably damaging 1.00
R0587:Piezo2 UTSW 18 63022426 missense possibly damaging 0.82
R0626:Piezo2 UTSW 18 63019258 missense probably damaging 0.97
R0734:Piezo2 UTSW 18 63041723 missense probably damaging 1.00
R0784:Piezo2 UTSW 18 63083235 missense probably damaging 1.00
R0973:Piezo2 UTSW 18 63015802 missense probably damaging 1.00
R1183:Piezo2 UTSW 18 63086753 missense probably damaging 1.00
R1344:Piezo2 UTSW 18 63021254 missense probably damaging 1.00
R1474:Piezo2 UTSW 18 63083131 missense probably damaging 1.00
R1571:Piezo2 UTSW 18 63144919 missense possibly damaging 0.67
R1643:Piezo2 UTSW 18 63082915 missense probably benign 0.03
R1649:Piezo2 UTSW 18 63117672 missense probably benign 0.34
R1741:Piezo2 UTSW 18 63021173 missense probably damaging 1.00
R1764:Piezo2 UTSW 18 63124642 missense possibly damaging 0.50
R1793:Piezo2 UTSW 18 63106284 missense possibly damaging 0.78
R1799:Piezo2 UTSW 18 63032840 critical splice donor site probably null
R1799:Piezo2 UTSW 18 63108087 missense probably damaging 1.00
R1868:Piezo2 UTSW 18 63019344 missense probably damaging 1.00
R1879:Piezo2 UTSW 18 63113960 missense probably damaging 1.00
R1962:Piezo2 UTSW 18 63078840 missense probably damaging 0.98
R1990:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1991:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1992:Piezo2 UTSW 18 63074662 missense probably null 1.00
R1995:Piezo2 UTSW 18 63078781 missense probably damaging 1.00
R2004:Piezo2 UTSW 18 63144926 missense probably damaging 1.00
R2011:Piezo2 UTSW 18 63059744 missense probably damaging 1.00
R2029:Piezo2 UTSW 18 63118935 missense possibly damaging 0.62
R2075:Piezo2 UTSW 18 63081734 missense probably damaging 1.00
R2078:Piezo2 UTSW 18 63117720 missense probably damaging 0.99
R2152:Piezo2 UTSW 18 63114041 missense probably damaging 1.00
R2162:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R2183:Piezo2 UTSW 18 63106274 missense probably damaging 1.00
R2230:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2231:Piezo2 UTSW 18 63145072 missense probably damaging 1.00
R2406:Piezo2 UTSW 18 63022525 missense probably damaging 1.00
R2431:Piezo2 UTSW 18 63245624 missense possibly damaging 0.95
R2876:Piezo2 UTSW 18 63053035 missense probably damaging 1.00
R2935:Piezo2 UTSW 18 63146843 missense probably damaging 1.00
R3004:Piezo2 UTSW 18 63024435 nonsense probably null
R3016:Piezo2 UTSW 18 63042832 missense probably damaging 1.00
R3794:Piezo2 UTSW 18 63081793 missense probably damaging 0.99
R3832:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3833:Piezo2 UTSW 18 63081662 critical splice donor site probably null
R3968:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3969:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R3970:Piezo2 UTSW 18 63011696 missense probably damaging 1.00
R4169:Piezo2 UTSW 18 63050604 missense probably benign
R4181:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4301:Piezo2 UTSW 18 63084840 missense probably damaging 1.00
R4302:Piezo2 UTSW 18 63124730 critical splice acceptor site probably null
R4475:Piezo2 UTSW 18 63102099 missense probably damaging 1.00
R4493:Piezo2 UTSW 18 63114063 missense probably damaging 0.98
R4519:Piezo2 UTSW 18 63072880 missense probably damaging 1.00
R4539:Piezo2 UTSW 18 63086628 missense probably damaging 1.00
R4687:Piezo2 UTSW 18 63069963 missense probably damaging 1.00
R4732:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4733:Piezo2 UTSW 18 63030401 missense probably damaging 1.00
R4825:Piezo2 UTSW 18 63144954 missense probably damaging 0.98
R4946:Piezo2 UTSW 18 63157262 missense probably benign
R4961:Piezo2 UTSW 18 63052961 splice site probably null
R4968:Piezo2 UTSW 18 63144971 nonsense probably null
R4973:Piezo2 UTSW 18 63074680 missense probably damaging 1.00
R4997:Piezo2 UTSW 18 63083113 missense probably damaging 1.00
R5078:Piezo2 UTSW 18 63024536 missense probably damaging 1.00
R5134:Piezo2 UTSW 18 63074620 missense probably damaging 1.00
R5151:Piezo2 UTSW 18 63030409 missense possibly damaging 0.72
R5209:Piezo2 UTSW 18 63032929 missense probably damaging 1.00
R5367:Piezo2 UTSW 18 63064731 missense probably damaging 1.00
R5401:Piezo2 UTSW 18 63084740 missense possibly damaging 0.81
R5464:Piezo2 UTSW 18 63145105 missense probably damaging 1.00
R5469:Piezo2 UTSW 18 63027864 missense probably damaging 1.00
R5650:Piezo2 UTSW 18 63011721 missense probably damaging 1.00
R5654:Piezo2 UTSW 18 63145091 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117696 missense possibly damaging 0.94
R5677:Piezo2 UTSW 18 63117697 missense probably benign 0.25
R5792:Piezo2 UTSW 18 63146856 missense probably damaging 1.00
R5874:Piezo2 UTSW 18 63027901 missense probably damaging 1.00
R5877:Piezo2 UTSW 18 63113934 missense probably benign 0.22
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6036:Piezo2 UTSW 18 63114948 nonsense probably null
R6073:Piezo2 UTSW 18 63012645 missense probably damaging 1.00
R6198:Piezo2 UTSW 18 63157210 nonsense probably null
R6255:Piezo2 UTSW 18 63121270 missense possibly damaging 0.75
R6259:Piezo2 UTSW 18 63117678 missense possibly damaging 0.69
R6391:Piezo2 UTSW 18 63106293 missense possibly damaging 0.79
R6446:Piezo2 UTSW 18 63086607 missense probably damaging 1.00
R6465:Piezo2 UTSW 18 63041663 missense possibly damaging 0.82
R6518:Piezo2 UTSW 18 63106271 missense probably damaging 0.99
R6521:Piezo2 UTSW 18 63021328 missense probably damaging 1.00
R6625:Piezo2 UTSW 18 63021262 missense probably damaging 1.00
R6744:Piezo2 UTSW 18 63032889 nonsense probably null
R6855:Piezo2 UTSW 18 63090879 critical splice donor site probably null
R6927:Piezo2 UTSW 18 63032986 missense probably damaging 1.00
R6980:Piezo2 UTSW 18 63082961 critical splice acceptor site probably null
R7141:Piezo2 UTSW 18 63145110 nonsense probably null
R7162:Piezo2 UTSW 18 63124709 missense possibly damaging 0.50
R7331:Piezo2 UTSW 18 63108030 missense probably damaging 0.99
R7382:Piezo2 UTSW 18 63017519 splice site probably null
R7395:Piezo2 UTSW 18 63027563 missense probably damaging 1.00
R7448:Piezo2 UTSW 18 63024472 missense probably damaging 1.00
R7465:Piezo2 UTSW 18 63012723 missense probably benign
R7517:Piezo2 UTSW 18 63082925 missense possibly damaging 0.52
R7577:Piezo2 UTSW 18 63053010 missense probably benign 0.01
R7612:Piezo2 UTSW 18 63042539 missense probably benign 0.12
R7829:Piezo2 UTSW 18 63113876 critical splice donor site probably null
R7835:Piezo2 UTSW 18 63082945 missense probably benign 0.12
R8014:Piezo2 UTSW 18 63083200 missense probably benign 0.02
R8055:Piezo2 UTSW 18 63042811 missense probably damaging 0.99
R8062:Piezo2 UTSW 18 63030466 missense possibly damaging 0.87
R8306:Piezo2 UTSW 18 63075730 missense probably damaging 1.00
R8332:Piezo2 UTSW 18 63012786 missense possibly damaging 0.67
R8355:Piezo2 UTSW 18 63090998 missense probably damaging 1.00
R8383:Piezo2 UTSW 18 63084688 missense probably damaging 0.97
R8455:Piezo2 UTSW 18 63090998 missense probably damaging 1.00
R8501:Piezo2 UTSW 18 63045540 missense probably damaging 0.99
R8523:Piezo2 UTSW 18 63146802 missense probably damaging 0.99
R8692:Piezo2 UTSW 18 63092900 nonsense probably null
R8708:Piezo2 UTSW 18 63093015 missense probably damaging 1.00
R8726:Piezo2 UTSW 18 63109885 missense probably benign
R8727:Piezo2 UTSW 18 63109885 missense probably benign
R8810:Piezo2 UTSW 18 63114963 missense probably benign 0.41
R8900:Piezo2 UTSW 18 63115025 missense probably benign 0.04
R9037:Piezo2 UTSW 18 63092831 missense probably benign 0.31
R9079:Piezo2 UTSW 18 63024466 missense probably damaging 1.00
R9090:Piezo2 UTSW 18 63030379 missense probably damaging 0.99
R9090:Piezo2 UTSW 18 63075719 missense probably damaging 0.99
R9123:Piezo2 UTSW 18 63045518 missense probably benign 0.00
R9125:Piezo2 UTSW 18 63045518 missense probably benign 0.00
R9171:Piezo2 UTSW 18 63045479 missense probably benign 0.04
R9194:Piezo2 UTSW 18 63117744 missense probably benign 0.03
R9203:Piezo2 UTSW 18 63157231 missense probably benign 0.00
R9209:Piezo2 UTSW 18 63021301 missense probably damaging 1.00
R9261:Piezo2 UTSW 18 63075797 missense possibly damaging 0.84
R9271:Piezo2 UTSW 18 63030379 missense probably damaging 0.99
R9271:Piezo2 UTSW 18 63075719 missense probably damaging 0.99
R9283:Piezo2 UTSW 18 63024566 missense probably damaging 1.00
R9377:Piezo2 UTSW 18 63029085 missense possibly damaging 0.48
R9499:Piezo2 UTSW 18 63032962 missense possibly damaging 0.67
R9531:Piezo2 UTSW 18 63102165 missense possibly damaging 0.95
R9551:Piezo2 UTSW 18 63032962 missense possibly damaging 0.67
X0017:Piezo2 UTSW 18 63027586 missense probably damaging 0.99
X0022:Piezo2 UTSW 18 63050610 missense probably benign 0.43
X0060:Piezo2 UTSW 18 63017577 missense probably benign 0.09
Z1088:Piezo2 UTSW 18 63069994 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CATGTGGACTGTTTATTCTCACACTG -3'
(R):5'- AAGTGGGATGCACAGAGCTC -3'

Sequencing Primer
(F):5'- GGACTGTTTATTCTCACACTGAAACC -3'
(R):5'- GCACAGAGCTCAGTACATGATTTGC -3'
Posted On 2016-03-17