Mutagenetix > Incidental Mutation

Incidental Mutation 'R4899:Epg5'

376052

Institutional Source

Beutler Lab

Gene Symbol

Epg5

Ensembl Gene

ENSMUSG00000039840

Gene Name

ectopic P-granules autophagy protein 5 homolog (C. elegans)

Synonyms

MMRRC Submission

042503-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.945) question?

Stock #

R4899 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

77938467-78035027 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 77985057 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 1271 (L1271Q)

Ref Sequence

ENSEMBL: ENSMUSP00000038681 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044622]

AlphaFold

Q80TA9

Predicted Effect

probably damaging
Transcript: ENSMUST00000044622
AA Change: L1271Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000038681
Gene: ENSMUSG00000039840
AA Change: L1271Q

Domain	Start	End	E-Value	Type
low complexity region	299	309	N/A	INTRINSIC
low complexity region	395	406	N/A	INTRINSIC
low complexity region	1074	1085	N/A	INTRINSIC
low complexity region	1499	1516	N/A	INTRINSIC
coiled coil region	1600	1626	N/A	INTRINSIC
low complexity region	2132	2145	N/A	INTRINSIC
low complexity region	2416	2427	N/A	INTRINSIC
low complexity region	2454	2469	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a large coiled coil domain-containing protein that functions in autophagy during starvation conditions. Mutations in this gene cause Vici syndrome. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit dysfunctional autophagy that leads to aggregate inclusions in motor neurons, motor neuron degeneration, denervation, muscle degeneration and premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 75 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010005H15Rik	A	T	16: 36,257,365	Y96F	possibly damaging	Het
9230110C19Rik	A	T	9: 8,022,493	S243T	possibly damaging	Het
Abhd18	C	G	3: 40,905,869		probably null	Het
Adra2c	A	T	5: 35,280,361	Y159F	probably damaging	Het
AI481877	T	C	4: 59,062,640	Y872C	probably damaging	Het
Alkal2	T	A	12: 30,884,973	S64T	probably benign	Het
Apbb1ip	T	C	2: 22,823,349	V72A	unknown	Het
Atp13a5	A	G	16: 29,378,500	L13P	probably damaging	Het
Azin2	G	A	4: 128,934,653	P254S	probably benign	Het
Bmpr1b	T	C	3: 141,840,683	R481G	probably damaging	Het
Cacna2d4	G	A	6: 119,268,196	W288*	probably null	Het
Cass4	A	G	2: 172,427,869	T626A	probably benign	Het
Cep112	T	A	11: 108,606,284	D683E	probably damaging	Het
Chat	G	T	14: 32,448,977	S188R	possibly damaging	Het
Cit	A	G	5: 115,863,028	Y162C	possibly damaging	Het
Clca3a1	T	A	3: 144,737,961	Y676F	probably damaging	Het
Clec2h	A	G	6: 128,675,824	N185D	probably benign	Het
Cnbd2	G	T	2: 156,339,221	V192F	probably benign	Het
Col6a3	C	A	1: 90,802,427	G1112V	probably damaging	Het
Cyp3a25	A	G	5: 145,977,671	F483S	possibly damaging	Het
Dscam	T	C	16: 96,683,818	E1103G	probably benign	Het
Dync2h1	G	A	9: 7,131,921	Q1629*	probably null	Het
E330014E10Rik	T	C	5: 95,801,727	V111A	probably benign	Het
Enpp6	A	G	8: 46,987,083	Y38C	probably damaging	Het
Fam47e	G	A	5: 92,574,669	V75I	probably benign	Het
Fat3	T	C	9: 15,969,799	D3259G	probably damaging	Het
Fbxw28	T	C	9: 109,330,853	D211G	probably damaging	Het
Flnc	A	G	6: 29,446,843	N990D	probably benign	Het
Frat1	T	G	19: 41,830,322	L52R	probably damaging	Het
Ftmt	C	G	18: 52,331,586		probably benign	Het
H2-M1	C	T	17: 36,671,220	G163D	probably benign	Het
Hapln1	A	G	13: 89,601,650	K105E	possibly damaging	Het
Igkv17-127	G	T	6: 67,861,397	A31S	probably benign	Het
Il6st	T	C	13: 112,501,161	L628P	probably damaging	Het
Kcnj6	A	G	16: 94,832,613	I213T	probably damaging	Het
Kidins220	T	C	12: 25,013,443		probably null	Het
Lama2	TTTGCGCATT	TTT	10: 27,043,643		probably null	Het
Llgl1	C	T	11: 60,709,568	P581L	probably benign	Het
Marc2	A	T	1: 184,845,624	I65N	probably damaging	Het
Mertk	C	A	2: 128,783,925	P660Q	probably damaging	Het
Mkl1	A	G	15: 81,018,386	Y241H	probably damaging	Het
Napepld	A	G	5: 21,683,440	Y4H	probably benign	Het
Ncam1	T	A	9: 49,545,251		probably null	Het
Nuak2	A	T	1: 132,324,986	K93*	probably null	Het
Oat	A	T	7: 132,564,222	D211E	probably benign	Het
Olfr1214	A	C	2: 88,988,110	L31V	probably null	Het
Olfr1355	A	T	10: 78,879,207	S12C	probably benign	Het
Olfr171	G	A	16: 19,624,200	A300V	probably benign	Het
Olfr348	A	G	2: 36,786,798	Q91R	probably benign	Het
Olfr64	A	G	7: 103,893,465	I90T	possibly damaging	Het
Pde4dip	C	A	3: 97,709,558	K1789N	probably damaging	Het
Piezo2	T	C	18: 63,078,791	I1322V	possibly damaging	Het
Pih1d1	A	G	7: 45,154,527		probably benign	Het
Plekhd1	T	C	12: 80,722,327	S454P	probably damaging	Het
Polr2h	G	A	16: 20,720,553	V89M	probably damaging	Het
Pptc7	G	A	5: 122,284,717	G17S	possibly damaging	Het
Ptpra	T	C	2: 130,544,436	V602A	probably damaging	Het
Rnf123	C	T	9: 108,063,680	R654H	probably damaging	Het
Rufy4	T	C	1: 74,147,663	C537R	probably damaging	Het
Samsn1	A	G	16: 75,879,103	S135P	probably damaging	Het
Sgsm3	A	G	15: 81,006,779	N147S	probably benign	Het
Slc22a29	T	C	19: 8,161,569	T510A	probably benign	Het
Smc4	T	A	3: 69,031,811	H978Q	probably damaging	Het
Sox7	G	A	14: 63,948,478	R321H	probably damaging	Het
Spred3	T	C	7: 29,161,833	D307G	probably damaging	Het
Syne2	T	A	12: 75,854,101	D11E	probably benign	Het
Tob1	ACAGCAGCAGCAGCAGCAGCAGCAGCA	ACAGCAGCAGCAGCAGCAGCAGCA	11: 94,214,452		probably benign	Het
Top2b	A	T	14: 16,387,313	I134F	probably damaging	Het
Tspan1	T	A	4: 116,163,366	R206*	probably null	Het
Ttc3	A	T	16: 94,429,455	N837I	probably damaging	Het
Vmn1r36	T	C	6: 66,716,565	T72A	possibly damaging	Het
Vmn2r10	A	G	5: 109,003,458	S97P	probably damaging	Het
Zfp2	T	A	11: 50,900,014	I401F	probably damaging	Het
Zfp629	T	C	7: 127,611,018	T540A	possibly damaging	Het
Zfr	G	A	15: 12,166,145	V834I	probably benign	Het

Other mutations in Epg5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01680:Epg5	APN	18	78012741	missense	probably damaging	1.00
IGL01778:Epg5	APN	18	78019274	missense	probably damaging	0.98
IGL01936:Epg5	APN	18	77985101	missense	probably damaging	1.00
IGL02189:Epg5	APN	18	78012870	missense	probably damaging	0.99
IGL02323:Epg5	APN	18	78012832	nonsense	probably null
IGL02567:Epg5	APN	18	78033073	missense	probably damaging	1.00
IGL02805:Epg5	APN	18	78030191	splice site	probably benign
IGL03282:Epg5	APN	18	77986426	missense	probably benign	0.25
stitch	UTSW	18	77948299	nonsense	probably null
R0011:Epg5	UTSW	18	77948483	missense	probably benign
R0172:Epg5	UTSW	18	78027359	missense	probably benign	0.00
R0335:Epg5	UTSW	18	77986472	missense	probably benign	0.25
R0380:Epg5	UTSW	18	77960841	missense	probably damaging	1.00
R0441:Epg5	UTSW	18	78023271	splice site	probably benign
R0443:Epg5	UTSW	18	77955903	splice site	probably benign
R0445:Epg5	UTSW	18	78014184	missense	possibly damaging	0.87
R0448:Epg5	UTSW	18	78023365	missense	probably damaging	1.00
R0892:Epg5	UTSW	18	77968628	missense	possibly damaging	0.94
R1081:Epg5	UTSW	18	77959533	missense	possibly damaging	0.92
R1183:Epg5	UTSW	18	77960711	missense	probably damaging	1.00
R1374:Epg5	UTSW	18	77981326	missense	probably benign
R1428:Epg5	UTSW	18	77962427	missense	probably damaging	1.00
R1727:Epg5	UTSW	18	78015815	missense	possibly damaging	0.94
R1780:Epg5	UTSW	18	78023990	missense	probably damaging	0.99
R1801:Epg5	UTSW	18	77983490	missense	possibly damaging	0.63
R1864:Epg5	UTSW	18	77975031	missense	probably damaging	0.99
R1908:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1909:Epg5	UTSW	18	77959032	missense	probably benign	0.26
R1916:Epg5	UTSW	18	77965021	missense	probably benign	0.00
R1986:Epg5	UTSW	18	77982306	critical splice acceptor site	probably null
R2048:Epg5	UTSW	18	78023987	missense	probably damaging	0.98
R2080:Epg5	UTSW	18	77948745	missense	probably benign	0.01
R2106:Epg5	UTSW	18	77991363	nonsense	probably null
R2144:Epg5	UTSW	18	77954197	missense	possibly damaging	0.78
R2151:Epg5	UTSW	18	78027302	missense	probably benign
R2217:Epg5	UTSW	18	77949072	missense	probably benign
R2424:Epg5	UTSW	18	77968613	missense	probably benign	0.05
R2909:Epg5	UTSW	18	77983476	missense	probably damaging	1.00
R3725:Epg5	UTSW	18	78017679	missense	probably benign	0.00
R3899:Epg5	UTSW	18	77957510	missense	probably damaging	1.00
R4019:Epg5	UTSW	18	78030450	missense	probably damaging	0.98
R4260:Epg5	UTSW	18	77959121	missense	possibly damaging	0.50
R4260:Epg5	UTSW	18	78015699	missense	probably damaging	1.00
R4448:Epg5	UTSW	18	77962461	missense	probably damaging	1.00
R4475:Epg5	UTSW	18	77948508	missense	probably benign
R4612:Epg5	UTSW	18	77982414	missense	possibly damaging	0.77
R4666:Epg5	UTSW	18	78012864	missense	probably benign	0.45
R4767:Epg5	UTSW	18	78023283	missense	possibly damaging	0.67
R4779:Epg5	UTSW	18	77991365	missense	probably benign	0.01
R4791:Epg5	UTSW	18	77948996	nonsense	probably null
R4797:Epg5	UTSW	18	78030399	missense	probably benign	0.00
R4812:Epg5	UTSW	18	77979184	missense	probably benign	0.01
R5000:Epg5	UTSW	18	77954161	missense	probably benign
R5031:Epg5	UTSW	18	78028948	missense	probably benign	0.00
R5050:Epg5	UTSW	18	77975941	missense	possibly damaging	0.55
R5114:Epg5	UTSW	18	77995613	missense	probably benign
R5144:Epg5	UTSW	18	78015680	missense	probably damaging	1.00
R5209:Epg5	UTSW	18	77951282	missense	probably damaging	1.00
R5213:Epg5	UTSW	18	78014834	missense	probably benign	0.01
R5270:Epg5	UTSW	18	77983563	missense	possibly damaging	0.79
R5324:Epg5	UTSW	18	77962445	missense	possibly damaging	0.94
R5443:Epg5	UTSW	18	78027497	missense	possibly damaging	0.55
R5503:Epg5	UTSW	18	77951207	missense	possibly damaging	0.81
R5593:Epg5	UTSW	18	77957474	missense	probably damaging	1.00
R5718:Epg5	UTSW	18	77986403	missense	probably damaging	1.00
R5773:Epg5	UTSW	18	77960825	missense	probably damaging	1.00
R5828:Epg5	UTSW	18	78020851	missense	probably damaging	0.99
R5847:Epg5	UTSW	18	78030055	missense	probably benign	0.06
R5858:Epg5	UTSW	18	77948299	nonsense	probably null
R5914:Epg5	UTSW	18	77959632	critical splice donor site	probably null
R6124:Epg5	UTSW	18	78030045	missense	probably benign
R6228:Epg5	UTSW	18	77948462	missense	possibly damaging	0.90
R6252:Epg5	UTSW	18	77985167	missense	probably damaging	1.00
R6269:Epg5	UTSW	18	77948370	missense	probably benign
R6312:Epg5	UTSW	18	77979211	missense	possibly damaging	0.72
R6320:Epg5	UTSW	18	77962398	missense	probably damaging	1.00
R6328:Epg5	UTSW	18	78028964	missense	possibly damaging	0.88
R6430:Epg5	UTSW	18	77975885	missense	probably damaging	1.00
R6458:Epg5	UTSW	18	77948254	missense	probably benign	0.03
R6852:Epg5	UTSW	18	78012891	missense	probably damaging	1.00
R6915:Epg5	UTSW	18	77979165	missense	probably benign	0.00
R6930:Epg5	UTSW	18	78014163	missense	probably damaging	0.99
R6932:Epg5	UTSW	18	77948609	missense	probably benign	0.00
R7127:Epg5	UTSW	18	78028925	missense	probably damaging	1.00
R7207:Epg5	UTSW	18	77948955	missense	probably damaging	1.00
R7225:Epg5	UTSW	18	78012702	missense	probably benign	0.45
R7358:Epg5	UTSW	18	77959037	missense	possibly damaging	0.78
R7414:Epg5	UTSW	18	77983532	missense	possibly damaging	0.65
R7437:Epg5	UTSW	18	78023278	missense	probably benign	0.01
R7535:Epg5	UTSW	18	78032926	missense	probably benign	0.18
R7586:Epg5	UTSW	18	78030060	missense	probably benign
R7651:Epg5	UTSW	18	77981400	nonsense	probably null
R7715:Epg5	UTSW	18	77968586	missense	probably damaging	1.00
R7753:Epg5	UTSW	18	77948345	missense	possibly damaging	0.92
R7981:Epg5	UTSW	18	78009714	critical splice donor site	probably null
R8114:Epg5	UTSW	18	78030150	missense	probably benign	0.41
R8124:Epg5	UTSW	18	77964996	missense	probably benign	0.05
R8307:Epg5	UTSW	18	78022679	missense	probably damaging	1.00
R8458:Epg5	UTSW	18	77948731	missense	probably benign	0.00
R8751:Epg5	UTSW	18	77965008	missense	probably benign	0.07
R8751:Epg5	UTSW	18	77965009	missense	possibly damaging	0.65
R8751:Epg5	UTSW	18	77965010	missense	probably benign	0.28
R8888:Epg5	UTSW	18	78012871	missense	possibly damaging	0.76
R8971:Epg5	UTSW	18	77979219	missense	probably damaging	1.00
R9045:Epg5	UTSW	18	77948799	missense	probably damaging	1.00
R9291:Epg5	UTSW	18	78012850	nonsense	probably null
R9327:Epg5	UTSW	18	77948220	missense	probably benign	0.00
R9365:Epg5	UTSW	18	77954742	missense	probably damaging	1.00
X0023:Epg5	UTSW	18	77968657	missense	probably damaging	0.99
X0060:Epg5	UTSW	18	77962485	missense	possibly damaging	0.94
Z1088:Epg5	UTSW	18	77959139	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCCTCACAGAGAAAGGCAGG -3'
(R):5'- CTCCACAGCATACAGATGGGAG -3'

Sequencing Primer
(F):5'- AGGCAGGCCTTTCTCTTGCTG -3'
(R):5'- TGCCAGGAGCTTACTACAGTACTG -3'

Posted On

2016-03-17