Incidental Mutation 'R4900:Abtb2'
ID 376065
Institutional Source Beutler Lab
Gene Symbol Abtb2
Ensembl Gene ENSMUSG00000032724
Gene Name ankyrin repeat and BTB domain containing 2
Synonyms BPOZ-2
MMRRC Submission 042504-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4900 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 103396655-103548768 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103397349 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 93 (E93G)
Ref Sequence ENSEMBL: ENSMUSP00000075566 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076212]
AlphaFold Q7TQI7
Predicted Effect possibly damaging
Transcript: ENSMUST00000076212
AA Change: E93G

PolyPhen 2 Score 0.615 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: E93G

DomainStartEndE-ValueType
low complexity region 29 48 N/A INTRINSIC
low complexity region 122 143 N/A INTRINSIC
Blast:H2A 186 301 2e-38 BLAST
low complexity region 366 376 N/A INTRINSIC
ANK 521 550 4.78e-7 SMART
ANK 567 596 6.26e-2 SMART
ANK 606 635 3.65e-3 SMART
ANK 649 678 5.52e2 SMART
ANK 715 746 1.84e3 SMART
BTB 844 946 9.15e-24 SMART
Meta Mutation Damage Score 0.3286 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,895,091 (GRCm39) V262A probably benign Het
Adam5 A C 8: 25,232,172 (GRCm39) probably null Het
Adam5 G A 8: 25,271,619 (GRCm39) T596I probably damaging Het
Adgrb2 T A 4: 129,907,668 (GRCm39) Y1001N probably damaging Het
Aox1 T G 1: 58,344,544 (GRCm39) S546A probably benign Het
Asic2 T C 11: 81,464,280 (GRCm39) probably benign Het
Bcl11b T A 12: 107,955,957 (GRCm39) N64I probably damaging Het
Cacna1g A G 11: 94,350,177 (GRCm39) F556S possibly damaging Het
Cbl A G 9: 44,064,166 (GRCm39) V790A probably benign Het
Cd300c2 A T 11: 114,891,807 (GRCm39) C22* probably null Het
Cdh11 C T 8: 103,374,090 (GRCm39) probably null Het
Ces2g C T 8: 105,693,989 (GRCm39) Q442* probably null Het
Cps1 A T 1: 67,200,063 (GRCm39) T404S probably damaging Het
Csf2rb2 A T 15: 78,170,174 (GRCm39) probably null Het
Csmd2 A G 4: 128,346,318 (GRCm39) Y1526C probably benign Het
Cyp2a12 C T 7: 26,730,640 (GRCm39) Q202* probably null Het
Cyp2c39 G A 19: 39,502,020 (GRCm39) M136I probably benign Het
Cyp2j13 G A 4: 95,947,280 (GRCm39) T257I probably damaging Het
Dnah8 T A 17: 30,965,949 (GRCm39) L2427Q probably damaging Het
Dop1b G T 16: 93,560,318 (GRCm39) probably null Het
Entrep1 A G 19: 23,952,790 (GRCm39) S507P possibly damaging Het
Epcam T C 17: 87,951,049 (GRCm39) V212A possibly damaging Het
Flt1 C A 5: 147,620,749 (GRCm39) A132S probably benign Het
Flvcr2 T A 12: 85,829,756 (GRCm39) V255D probably damaging Het
Galc G T 12: 98,197,731 (GRCm39) T326K probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gen1 A T 12: 11,291,561 (GRCm39) Y808N probably benign Het
Glis1 C T 4: 107,476,761 (GRCm39) A306V probably damaging Het
Gm10638 A G 8: 87,473,028 (GRCm39) probably benign Het
Gm12789 G A 4: 101,846,182 (GRCm39) probably benign Het
Gm27048 C T 8: 81,661,228 (GRCm39) noncoding transcript Het
Gm4204 T C 1: 135,160,556 (GRCm39) noncoding transcript Het
Gm904 A T 13: 50,799,325 (GRCm39) I95F possibly damaging Het
Gvin3 T G 7: 106,197,793 (GRCm39) noncoding transcript Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Ints11 G A 4: 155,972,887 (GRCm39) D526N probably benign Het
Itfg2 A G 6: 128,393,279 (GRCm39) probably benign Het
Jund T C 8: 71,152,254 (GRCm39) V183A probably damaging Het
Kcnj8 A G 6: 142,512,221 (GRCm39) S129P probably damaging Het
Kcnq3 A G 15: 65,867,259 (GRCm39) S795P probably damaging Het
Lhx8 G T 3: 154,035,925 (GRCm39) A22E probably benign Het
Lrp8 A G 4: 107,664,006 (GRCm39) probably benign Het
Lvrn G T 18: 47,026,768 (GRCm39) A789S probably damaging Het
Lvrn T C 18: 47,014,479 (GRCm39) S526P probably damaging Het
Mga T A 2: 119,794,535 (GRCm39) C2622S possibly damaging Het
Mroh8 T C 2: 157,070,647 (GRCm39) E568G probably benign Het
Ms4a4b C A 19: 11,440,503 (GRCm39) probably benign Het
Muc2 T C 7: 141,303,280 (GRCm39) F99S probably benign Het
Myo5c T A 9: 75,180,825 (GRCm39) I738N probably damaging Het
Naip6 A C 13: 100,433,477 (GRCm39) V1120G probably damaging Het
Ncl T C 1: 86,283,901 (GRCm39) T307A probably benign Het
Npr1 A T 3: 90,363,272 (GRCm39) D869E possibly damaging Het
Nup93 A G 8: 95,013,231 (GRCm39) T36A probably benign Het
Olfml2b C A 1: 170,489,947 (GRCm39) T189N probably damaging Het
Or4c12b A G 2: 89,647,312 (GRCm39) N208S possibly damaging Het
Or8b9 T C 9: 37,766,608 (GRCm39) F165L probably benign Het
P4htm A C 9: 108,456,427 (GRCm39) W458G probably damaging Het
Pdzrn4 G T 15: 92,668,638 (GRCm39) R930L probably damaging Het
Pgam5 G A 5: 110,408,301 (GRCm39) A240V probably damaging Het
Prex2 T C 1: 11,220,129 (GRCm39) probably benign Het
Ptpru T G 4: 131,515,693 (GRCm39) E897A probably damaging Het
Rapgef2 A T 3: 78,981,670 (GRCm39) N1256K probably benign Het
Rhbdl3 A G 11: 80,210,439 (GRCm39) E64G probably benign Het
Sel1l3 A T 5: 53,289,184 (GRCm39) L879Q probably damaging Het
Siah1a G T 8: 87,451,703 (GRCm39) D260E probably benign Het
Skint6 T C 4: 112,924,667 (GRCm39) I522V probably benign Het
Slco4c1 G A 1: 96,768,953 (GRCm39) P303L probably damaging Het
Smok3c T C 5: 138,062,813 (GRCm39) I100T probably damaging Het
Snx24 C A 18: 53,518,295 (GRCm39) Y141* probably null Het
Tigit A G 16: 43,469,594 (GRCm39) S166P probably damaging Het
Tmem183a C T 1: 134,275,904 (GRCm39) R324Q probably benign Het
Tmie T C 9: 110,696,001 (GRCm39) D130G possibly damaging Het
Uggt1 G A 1: 36,241,936 (GRCm39) R333* probably null Het
Vmn2r111 T C 17: 22,767,637 (GRCm39) N620S possibly damaging Het
Vmn2r12 T A 5: 109,240,852 (GRCm39) N87I probably damaging Het
Vmn2r92 A G 17: 18,404,605 (GRCm39) D583G probably benign Het
Zdhhc17 T C 10: 110,821,819 (GRCm39) D60G possibly damaging Het
Other mutations in Abtb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01161:Abtb2 APN 2 103,535,463 (GRCm39) missense probably benign 0.00
IGL02605:Abtb2 APN 2 103,547,602 (GRCm39) missense probably benign
IGL03161:Abtb2 APN 2 103,397,799 (GRCm39) missense probably benign 0.02
PIT4504001:Abtb2 UTSW 2 103,547,537 (GRCm39) nonsense probably null
R0147:Abtb2 UTSW 2 103,397,480 (GRCm39) missense probably benign 0.04
R1052:Abtb2 UTSW 2 103,535,417 (GRCm39) missense possibly damaging 0.46
R1419:Abtb2 UTSW 2 103,539,765 (GRCm39) missense probably benign 0.00
R1518:Abtb2 UTSW 2 103,539,629 (GRCm39) missense probably benign 0.03
R1650:Abtb2 UTSW 2 103,532,747 (GRCm39) missense probably damaging 1.00
R1795:Abtb2 UTSW 2 103,397,369 (GRCm39) missense probably benign 0.00
R2054:Abtb2 UTSW 2 103,535,462 (GRCm39) missense probably benign 0.41
R2101:Abtb2 UTSW 2 103,397,207 (GRCm39) missense probably benign 0.05
R2363:Abtb2 UTSW 2 103,397,528 (GRCm39) missense probably damaging 1.00
R3440:Abtb2 UTSW 2 103,397,577 (GRCm39) missense probably benign 0.43
R3927:Abtb2 UTSW 2 103,538,563 (GRCm39) splice site probably null
R4351:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4352:Abtb2 UTSW 2 103,513,738 (GRCm39) missense possibly damaging 0.46
R4782:Abtb2 UTSW 2 103,547,644 (GRCm39) missense probably benign 0.35
R4814:Abtb2 UTSW 2 103,547,632 (GRCm39) missense probably benign 0.08
R4831:Abtb2 UTSW 2 103,513,820 (GRCm39) missense probably benign 0.06
R5038:Abtb2 UTSW 2 103,397,408 (GRCm39) missense probably damaging 0.99
R5513:Abtb2 UTSW 2 103,539,623 (GRCm39) critical splice acceptor site probably null
R6119:Abtb2 UTSW 2 103,532,655 (GRCm39) missense probably benign 0.00
R6298:Abtb2 UTSW 2 103,539,833 (GRCm39) missense probably benign 0.10
R6383:Abtb2 UTSW 2 103,397,721 (GRCm39) missense probably damaging 0.98
R6860:Abtb2 UTSW 2 103,539,770 (GRCm39) nonsense probably null
R7000:Abtb2 UTSW 2 103,542,787 (GRCm39) missense possibly damaging 0.85
R7109:Abtb2 UTSW 2 103,545,860 (GRCm39) missense probably benign 0.20
R7176:Abtb2 UTSW 2 103,539,720 (GRCm39) missense probably benign 0.00
R7189:Abtb2 UTSW 2 103,397,861 (GRCm39) missense probably benign 0.00
R7199:Abtb2 UTSW 2 103,397,565 (GRCm39) missense possibly damaging 0.74
R7299:Abtb2 UTSW 2 103,532,769 (GRCm39) splice site probably null
R7347:Abtb2 UTSW 2 103,397,757 (GRCm39) missense probably damaging 1.00
R7469:Abtb2 UTSW 2 103,397,292 (GRCm39) missense probably benign 0.00
R7629:Abtb2 UTSW 2 103,513,838 (GRCm39) critical splice donor site probably null
R7862:Abtb2 UTSW 2 103,532,626 (GRCm39) missense probably damaging 1.00
R8200:Abtb2 UTSW 2 103,531,162 (GRCm39) missense probably benign 0.02
R8682:Abtb2 UTSW 2 103,397,720 (GRCm39) missense probably benign 0.36
R8700:Abtb2 UTSW 2 103,397,289 (GRCm39) missense probably damaging 0.99
R9164:Abtb2 UTSW 2 103,541,829 (GRCm39) missense possibly damaging 0.50
R9196:Abtb2 UTSW 2 103,513,647 (GRCm39) missense possibly damaging 0.71
R9254:Abtb2 UTSW 2 103,541,580 (GRCm39) missense probably benign 0.00
R9258:Abtb2 UTSW 2 103,546,410 (GRCm39) missense probably null 0.99
R9343:Abtb2 UTSW 2 103,547,505 (GRCm39) missense probably benign
R9427:Abtb2 UTSW 2 103,531,244 (GRCm39) missense probably damaging 1.00
R9675:Abtb2 UTSW 2 103,538,532 (GRCm39) missense probably benign
Z1176:Abtb2 UTSW 2 103,538,517 (GRCm39) nonsense probably null
Z1177:Abtb2 UTSW 2 103,541,541 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAAGTCCAACTCGCAG -3'
(R):5'- TAGAGGGACAACGCCTTGAC -3'

Sequencing Primer
(F):5'- AGGCGCTCAACTCTTCGG -3'
(R):5'- TCGAAGCGGGTGCACTTAG -3'
Posted On 2016-03-17