Incidental Mutation 'R4900:Skint6'
ID 376075
Institutional Source Beutler Lab
Gene Symbol Skint6
Ensembl Gene ENSMUSG00000087194
Gene Name selection and upkeep of intraepithelial T cells 6
Synonyms OTTMUSG00000008519
MMRRC Submission 042504-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.063) question?
Stock # R4900 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 112661813-113144170 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 112924667 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Valine at position 522 (I522V)
Ref Sequence ENSEMBL: ENSMUSP00000132312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000138966] [ENSMUST00000171224]
AlphaFold A7XUZ6
Predicted Effect probably benign
Transcript: ENSMUST00000138966
AA Change: I522V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000121870
Gene: ENSMUSG00000087194
AA Change: I522V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000171224
AA Change: I522V

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000132312
Gene: ENSMUSG00000087194
AA Change: I522V

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
IGv 44 125 2.32e-8 SMART
internal_repeat_1 219 594 1.11e-41 PROSPERO
low complexity region 601 610 N/A INTRINSIC
low complexity region 678 690 N/A INTRINSIC
internal_repeat_1 701 1076 1.11e-41 PROSPERO
transmembrane domain 1087 1104 N/A INTRINSIC
transmembrane domain 1164 1186 N/A INTRINSIC
transmembrane domain 1206 1228 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,895,091 (GRCm39) V262A probably benign Het
Abtb2 A G 2: 103,397,349 (GRCm39) E93G possibly damaging Het
Adam5 A C 8: 25,232,172 (GRCm39) probably null Het
Adam5 G A 8: 25,271,619 (GRCm39) T596I probably damaging Het
Adgrb2 T A 4: 129,907,668 (GRCm39) Y1001N probably damaging Het
Aox1 T G 1: 58,344,544 (GRCm39) S546A probably benign Het
Asic2 T C 11: 81,464,280 (GRCm39) probably benign Het
Bcl11b T A 12: 107,955,957 (GRCm39) N64I probably damaging Het
Cacna1g A G 11: 94,350,177 (GRCm39) F556S possibly damaging Het
Cbl A G 9: 44,064,166 (GRCm39) V790A probably benign Het
Cd300c2 A T 11: 114,891,807 (GRCm39) C22* probably null Het
Cdh11 C T 8: 103,374,090 (GRCm39) probably null Het
Ces2g C T 8: 105,693,989 (GRCm39) Q442* probably null Het
Cps1 A T 1: 67,200,063 (GRCm39) T404S probably damaging Het
Csf2rb2 A T 15: 78,170,174 (GRCm39) probably null Het
Csmd2 A G 4: 128,346,318 (GRCm39) Y1526C probably benign Het
Cyp2a12 C T 7: 26,730,640 (GRCm39) Q202* probably null Het
Cyp2c39 G A 19: 39,502,020 (GRCm39) M136I probably benign Het
Cyp2j13 G A 4: 95,947,280 (GRCm39) T257I probably damaging Het
Dnah8 T A 17: 30,965,949 (GRCm39) L2427Q probably damaging Het
Dop1b G T 16: 93,560,318 (GRCm39) probably null Het
Entrep1 A G 19: 23,952,790 (GRCm39) S507P possibly damaging Het
Epcam T C 17: 87,951,049 (GRCm39) V212A possibly damaging Het
Flt1 C A 5: 147,620,749 (GRCm39) A132S probably benign Het
Flvcr2 T A 12: 85,829,756 (GRCm39) V255D probably damaging Het
Galc G T 12: 98,197,731 (GRCm39) T326K probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,266,820 (GRCm39) probably benign Het
Gen1 A T 12: 11,291,561 (GRCm39) Y808N probably benign Het
Glis1 C T 4: 107,476,761 (GRCm39) A306V probably damaging Het
Gm10638 A G 8: 87,473,028 (GRCm39) probably benign Het
Gm12789 G A 4: 101,846,182 (GRCm39) probably benign Het
Gm27048 C T 8: 81,661,228 (GRCm39) noncoding transcript Het
Gm4204 T C 1: 135,160,556 (GRCm39) noncoding transcript Het
Gm904 A T 13: 50,799,325 (GRCm39) I95F possibly damaging Het
Gvin3 T G 7: 106,197,793 (GRCm39) noncoding transcript Het
Hjurp GT GTT 1: 88,194,246 (GRCm39) probably null Het
Ints11 G A 4: 155,972,887 (GRCm39) D526N probably benign Het
Itfg2 A G 6: 128,393,279 (GRCm39) probably benign Het
Jund T C 8: 71,152,254 (GRCm39) V183A probably damaging Het
Kcnj8 A G 6: 142,512,221 (GRCm39) S129P probably damaging Het
Kcnq3 A G 15: 65,867,259 (GRCm39) S795P probably damaging Het
Lhx8 G T 3: 154,035,925 (GRCm39) A22E probably benign Het
Lrp8 A G 4: 107,664,006 (GRCm39) probably benign Het
Lvrn G T 18: 47,026,768 (GRCm39) A789S probably damaging Het
Lvrn T C 18: 47,014,479 (GRCm39) S526P probably damaging Het
Mga T A 2: 119,794,535 (GRCm39) C2622S possibly damaging Het
Mroh8 T C 2: 157,070,647 (GRCm39) E568G probably benign Het
Ms4a4b C A 19: 11,440,503 (GRCm39) probably benign Het
Muc2 T C 7: 141,303,280 (GRCm39) F99S probably benign Het
Myo5c T A 9: 75,180,825 (GRCm39) I738N probably damaging Het
Naip6 A C 13: 100,433,477 (GRCm39) V1120G probably damaging Het
Ncl T C 1: 86,283,901 (GRCm39) T307A probably benign Het
Npr1 A T 3: 90,363,272 (GRCm39) D869E possibly damaging Het
Nup93 A G 8: 95,013,231 (GRCm39) T36A probably benign Het
Olfml2b C A 1: 170,489,947 (GRCm39) T189N probably damaging Het
Or4c12b A G 2: 89,647,312 (GRCm39) N208S possibly damaging Het
Or8b9 T C 9: 37,766,608 (GRCm39) F165L probably benign Het
P4htm A C 9: 108,456,427 (GRCm39) W458G probably damaging Het
Pdzrn4 G T 15: 92,668,638 (GRCm39) R930L probably damaging Het
Pgam5 G A 5: 110,408,301 (GRCm39) A240V probably damaging Het
Prex2 T C 1: 11,220,129 (GRCm39) probably benign Het
Ptpru T G 4: 131,515,693 (GRCm39) E897A probably damaging Het
Rapgef2 A T 3: 78,981,670 (GRCm39) N1256K probably benign Het
Rhbdl3 A G 11: 80,210,439 (GRCm39) E64G probably benign Het
Sel1l3 A T 5: 53,289,184 (GRCm39) L879Q probably damaging Het
Siah1a G T 8: 87,451,703 (GRCm39) D260E probably benign Het
Slco4c1 G A 1: 96,768,953 (GRCm39) P303L probably damaging Het
Smok3c T C 5: 138,062,813 (GRCm39) I100T probably damaging Het
Snx24 C A 18: 53,518,295 (GRCm39) Y141* probably null Het
Tigit A G 16: 43,469,594 (GRCm39) S166P probably damaging Het
Tmem183a C T 1: 134,275,904 (GRCm39) R324Q probably benign Het
Tmie T C 9: 110,696,001 (GRCm39) D130G possibly damaging Het
Uggt1 G A 1: 36,241,936 (GRCm39) R333* probably null Het
Vmn2r111 T C 17: 22,767,637 (GRCm39) N620S possibly damaging Het
Vmn2r12 T A 5: 109,240,852 (GRCm39) N87I probably damaging Het
Vmn2r92 A G 17: 18,404,605 (GRCm39) D583G probably benign Het
Zdhhc17 T C 10: 110,821,819 (GRCm39) D60G possibly damaging Het
Other mutations in Skint6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01123:Skint6 APN 4 112,661,879 (GRCm39) missense possibly damaging 0.96
IGL01296:Skint6 APN 4 113,093,637 (GRCm39) missense probably benign 0.37
IGL01343:Skint6 APN 4 113,140,823 (GRCm39) missense probably benign 0.07
IGL01543:Skint6 APN 4 112,757,160 (GRCm39) missense probably benign 0.18
IGL01633:Skint6 APN 4 113,095,246 (GRCm39) missense probably damaging 1.00
IGL01818:Skint6 APN 4 112,805,766 (GRCm39) missense probably benign 0.18
IGL02124:Skint6 APN 4 112,944,993 (GRCm39) missense probably benign
IGL02517:Skint6 APN 4 112,805,737 (GRCm39) splice site probably benign
IGL02647:Skint6 APN 4 112,985,088 (GRCm39) splice site probably benign
IGL02887:Skint6 APN 4 113,095,381 (GRCm39) nonsense probably null
IGL03026:Skint6 APN 4 112,848,441 (GRCm39) splice site probably null
IGL03030:Skint6 APN 4 112,870,153 (GRCm39) missense probably benign 0.03
meissner UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
Tegmentum UTSW 4 112,700,019 (GRCm39) splice site probably null
PIT4576001:Skint6 UTSW 4 112,910,564 (GRCm39) missense possibly damaging 0.91
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0058:Skint6 UTSW 4 112,904,012 (GRCm39) splice site probably benign
R0099:Skint6 UTSW 4 112,668,698 (GRCm39) missense possibly damaging 0.53
R0158:Skint6 UTSW 4 113,042,011 (GRCm39) splice site probably benign
R0164:Skint6 UTSW 4 112,848,433 (GRCm39) splice site probably benign
R0312:Skint6 UTSW 4 112,666,297 (GRCm39) missense possibly damaging 0.86
R0591:Skint6 UTSW 4 112,715,366 (GRCm39) splice site probably benign
R0762:Skint6 UTSW 4 112,722,848 (GRCm39) splice site probably benign
R0941:Skint6 UTSW 4 113,095,555 (GRCm39) missense probably damaging 1.00
R1023:Skint6 UTSW 4 113,095,300 (GRCm39) missense probably benign 0.20
R1132:Skint6 UTSW 4 112,755,296 (GRCm39) critical splice donor site probably null
R1228:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign
R1338:Skint6 UTSW 4 112,870,158 (GRCm39) missense possibly damaging 0.53
R1432:Skint6 UTSW 4 112,726,721 (GRCm39) splice site probably benign
R1512:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R1577:Skint6 UTSW 4 113,005,720 (GRCm39) missense possibly damaging 0.53
R1733:Skint6 UTSW 4 113,034,234 (GRCm39) splice site probably benign
R1762:Skint6 UTSW 4 113,093,678 (GRCm39) missense probably damaging 0.98
R1891:Skint6 UTSW 4 112,703,893 (GRCm39) missense possibly damaging 0.85
R1908:Skint6 UTSW 4 112,749,187 (GRCm39) missense probably benign
R2069:Skint6 UTSW 4 113,095,329 (GRCm39) missense probably damaging 1.00
R2089:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2091:Skint6 UTSW 4 112,703,881 (GRCm39) missense probably benign
R2144:Skint6 UTSW 4 113,093,457 (GRCm39) missense possibly damaging 0.84
R2166:Skint6 UTSW 4 112,711,649 (GRCm39) missense probably benign 0.01
R2192:Skint6 UTSW 4 112,722,909 (GRCm39) nonsense probably null
R2267:Skint6 UTSW 4 112,700,019 (GRCm39) splice site probably null
R2312:Skint6 UTSW 4 113,095,339 (GRCm39) missense probably damaging 1.00
R2324:Skint6 UTSW 4 112,729,654 (GRCm39) splice site probably null
R2342:Skint6 UTSW 4 113,034,180 (GRCm39) missense probably benign 0.00
R3028:Skint6 UTSW 4 113,093,690 (GRCm39) missense possibly damaging 0.92
R3704:Skint6 UTSW 4 112,993,669 (GRCm39) missense possibly damaging 0.86
R3752:Skint6 UTSW 4 112,700,096 (GRCm39) splice site probably benign
R3760:Skint6 UTSW 4 112,794,655 (GRCm39) missense possibly damaging 0.53
R3827:Skint6 UTSW 4 112,794,634 (GRCm39) missense probably benign
R4377:Skint6 UTSW 4 113,093,715 (GRCm39) missense possibly damaging 0.90
R4406:Skint6 UTSW 4 113,013,683 (GRCm39) missense probably benign 0.01
R4611:Skint6 UTSW 4 112,931,273 (GRCm39) missense probably benign
R4780:Skint6 UTSW 4 113,093,594 (GRCm39) missense probably damaging 0.98
R4788:Skint6 UTSW 4 113,095,533 (GRCm39) missense possibly damaging 0.54
R4818:Skint6 UTSW 4 112,812,589 (GRCm39) intron probably benign
R4972:Skint6 UTSW 4 112,692,265 (GRCm39) missense probably benign
R5008:Skint6 UTSW 4 112,848,452 (GRCm39) missense possibly damaging 0.86
R5016:Skint6 UTSW 4 113,028,730 (GRCm39) critical splice acceptor site probably null
R5085:Skint6 UTSW 4 113,093,465 (GRCm39) missense probably damaging 0.99
R5165:Skint6 UTSW 4 112,722,865 (GRCm39) missense possibly damaging 0.86
R5221:Skint6 UTSW 4 112,752,121 (GRCm39) splice site probably null
R5310:Skint6 UTSW 4 113,041,965 (GRCm39) nonsense probably null
R5423:Skint6 UTSW 4 112,707,937 (GRCm39) missense possibly damaging 0.93
R5436:Skint6 UTSW 4 112,953,788 (GRCm39) missense probably benign 0.08
R5447:Skint6 UTSW 4 112,963,106 (GRCm39) missense probably benign 0.34
R5564:Skint6 UTSW 4 112,846,162 (GRCm39) missense possibly damaging 0.72
R5629:Skint6 UTSW 4 112,870,176 (GRCm39) missense possibly damaging 0.86
R5936:Skint6 UTSW 4 112,953,790 (GRCm39) missense probably benign 0.33
R5993:Skint6 UTSW 4 112,666,276 (GRCm39) missense probably benign 0.02
R6027:Skint6 UTSW 4 112,953,761 (GRCm39) splice site probably null
R6174:Skint6 UTSW 4 112,696,510 (GRCm39) missense possibly damaging 0.53
R6497:Skint6 UTSW 4 113,093,595 (GRCm39) missense probably damaging 0.98
R6552:Skint6 UTSW 4 112,924,687 (GRCm39) missense possibly damaging 0.86
R6645:Skint6 UTSW 4 112,749,235 (GRCm39) missense possibly damaging 0.53
R6810:Skint6 UTSW 4 112,805,577 (GRCm39) splice site probably null
R7003:Skint6 UTSW 4 112,963,109 (GRCm39) missense probably benign 0.01
R7211:Skint6 UTSW 4 113,095,566 (GRCm39) missense probably benign 0.09
R7269:Skint6 UTSW 4 112,711,686 (GRCm39) splice site probably null
R7398:Skint6 UTSW 4 112,755,335 (GRCm39) missense probably benign 0.00
R7438:Skint6 UTSW 4 113,095,425 (GRCm39) missense probably damaging 1.00
R7461:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7536:Skint6 UTSW 4 112,668,744 (GRCm39) critical splice acceptor site probably null
R7613:Skint6 UTSW 4 113,034,243 (GRCm39) splice site probably null
R7956:Skint6 UTSW 4 112,703,894 (GRCm39) missense possibly damaging 0.85
R8118:Skint6 UTSW 4 113,013,691 (GRCm39) missense possibly damaging 0.73
R8118:Skint6 UTSW 4 112,722,872 (GRCm39) missense possibly damaging 0.53
R8197:Skint6 UTSW 4 112,752,040 (GRCm39) splice site probably null
R8218:Skint6 UTSW 4 112,696,471 (GRCm39) splice site probably null
R8344:Skint6 UTSW 4 113,093,642 (GRCm39) missense probably damaging 1.00
R8518:Skint6 UTSW 4 113,095,465 (GRCm39) missense possibly damaging 0.58
R8776:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8776-TAIL:Skint6 UTSW 4 112,661,885 (GRCm39) missense possibly damaging 0.96
R8794:Skint6 UTSW 4 113,049,869 (GRCm39) missense possibly damaging 0.73
R8796:Skint6 UTSW 4 112,661,891 (GRCm39) missense possibly damaging 0.86
R8812:Skint6 UTSW 4 112,846,149 (GRCm39) missense probably benign 0.00
R8866:Skint6 UTSW 4 112,711,650 (GRCm39) missense probably benign
R8881:Skint6 UTSW 4 112,672,716 (GRCm39) missense possibly damaging 0.53
R8949:Skint6 UTSW 4 112,931,296 (GRCm39) missense probably benign 0.04
R8967:Skint6 UTSW 4 112,729,701 (GRCm39) nonsense probably null
R9005:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9007:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9053:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9055:Skint6 UTSW 4 113,095,347 (GRCm39) missense probably damaging 1.00
R9144:Skint6 UTSW 4 112,985,102 (GRCm39) missense possibly damaging 0.73
R9149:Skint6 UTSW 4 113,034,173 (GRCm39) missense probably damaging 0.98
R9297:Skint6 UTSW 4 112,668,717 (GRCm39) missense probably benign 0.00
R9388:Skint6 UTSW 4 113,049,838 (GRCm39) missense possibly damaging 0.85
R9407:Skint6 UTSW 4 113,034,224 (GRCm39) missense possibly damaging 0.53
R9475:Skint6 UTSW 4 112,664,037 (GRCm39) critical splice donor site probably null
R9515:Skint6 UTSW 4 112,715,375 (GRCm39) missense probably benign
R9572:Skint6 UTSW 4 112,985,128 (GRCm39) missense probably benign
R9689:Skint6 UTSW 4 113,093,546 (GRCm39) missense probably damaging 0.99
R9744:Skint6 UTSW 4 112,666,360 (GRCm39) missense probably damaging 1.00
R9785:Skint6 UTSW 4 112,740,884 (GRCm39) missense possibly damaging 0.86
Z1176:Skint6 UTSW 4 113,095,491 (GRCm39) missense probably damaging 0.96
Z1176:Skint6 UTSW 4 112,749,211 (GRCm39) missense possibly damaging 0.53
Z1176:Skint6 UTSW 4 113,095,492 (GRCm39) missense possibly damaging 0.83
Z1177:Skint6 UTSW 4 112,963,158 (GRCm39) critical splice acceptor site probably null
Z1177:Skint6 UTSW 4 112,664,125 (GRCm39) missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- TTGGCCTAGGATCAAGAAGCTG -3'
(R):5'- TGTCAGAGCCCAGCATTTC -3'

Sequencing Primer
(F):5'- GCCTAGGATCAAGAAGCTGAATATTC -3'
(R):5'- AGCCCAGCATTTCTTGTTGCAATAG -3'
Posted On 2016-03-17