Mutagenetix > Incidental Mutation

Incidental Mutation 'R4900:Sel1l3'

376080

Institutional Source

Beutler Lab

Gene Symbol

Sel1l3

Ensembl Gene

ENSMUSG00000029189

Gene Name

sel-1 suppressor of lin-12-like 3 (C. elegans)

Synonyms

2310045A20Rik

MMRRC Submission

042504-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4900 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

53107083-53213927 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 53131842 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Glutamine at position 879 (L879Q)

Ref Sequence

ENSEMBL: ENSMUSP00000031090 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000031090]

AlphaFold

Q80TS8

Predicted Effect

probably damaging
Transcript: ENSMUST00000031090
AA Change: L879Q

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000031090
Gene: ENSMUSG00000029189
AA Change: L879Q

Domain	Start	End	E-Value	Type
low complexity region	11	33	N/A	INTRINSIC
SEL1	575	609	3.39e1	SMART
SEL1	611	647	1.85e1	SMART
SEL1	694	730	5.27e-5	SMART
SEL1	732	767	2.94e-3	SMART
SEL1	768	800	5.32e-1	SMART
SEL1	801	839	1.23e-5	SMART
SEL1	840	877	8.55e1	SMART
SEL1	952	988	2.56e-3	SMART
low complexity region	1048	1058	N/A	INTRINSIC
transmembrane domain	1065	1087	N/A	INTRINSIC
low complexity region	1102	1127	N/A	INTRINSIC

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

100% (84/84)

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	T	C	6: 91,918,110	V262A	probably benign	Het
Abtb2	A	G	2: 103,567,004	E93G	possibly damaging	Het
Adam5	A	C	8: 24,742,156		probably null	Het
Adam5	G	A	8: 24,781,603	T596I	probably damaging	Het
Adgrb2	T	A	4: 130,013,875	Y1001N	probably damaging	Het
Aox2	T	G	1: 58,305,385	S546A	probably benign	Het
Asic2	T	C	11: 81,573,454		probably benign	Het
Bcl11b	T	A	12: 107,989,698	N64I	probably damaging	Het
Cacna1g	A	G	11: 94,459,351	F556S	possibly damaging	Het
Cbl	A	G	9: 44,152,869	V790A	probably benign	Het
Cd300c2	A	T	11: 115,000,981	C22*	probably null	Het
Cdh11	C	T	8: 102,647,458		probably null	Het
Ces2g	C	T	8: 104,967,357	Q442*	probably null	Het
Cps1	A	T	1: 67,160,904	T404S	probably damaging	Het
Csf2rb2	A	T	15: 78,285,974		probably null	Het
Csmd2	A	G	4: 128,452,525	Y1526C	probably benign	Het
Cyp2a12	C	T	7: 27,031,215	Q202*	probably null	Het
Cyp2c39	G	A	19: 39,513,576	M136I	probably benign	Het
Cyp2j13	G	A	4: 96,059,043	T257I	probably damaging	Het
Dnah8	T	A	17: 30,746,975	L2427Q	probably damaging	Het
Dopey2	G	T	16: 93,763,430		probably null	Het
Epcam	T	C	17: 87,643,621	V212A	possibly damaging	Het
Fam189a2	A	G	19: 23,975,426	S507P	possibly damaging	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Flvcr2	T	A	12: 85,782,982	V255D	probably damaging	Het
Galc	G	T	12: 98,231,472	T326K	probably damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gen1	A	T	12: 11,241,560	Y808N	probably benign	Het
Glis1	C	T	4: 107,619,564	A306V	probably damaging	Het
Gm10638	A	G	8: 86,746,400		probably benign	Het
Gm12789	G	A	4: 101,988,985		probably benign	Het
Gm1966	T	G	7: 106,598,586		noncoding transcript	Het
Gm27048	C	T	8: 80,934,599		noncoding transcript	Het
Gm4204	T	C	1: 135,232,818		noncoding transcript	Het
Gm904	A	T	13: 50,645,289	I95F	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Ints11	G	A	4: 155,888,430	D526N	probably benign	Het
Itfg2	A	G	6: 128,416,316		probably benign	Het
Jund	T	C	8: 70,699,605	V183A	probably damaging	Het
Kcnj8	A	G	6: 142,566,495	S129P	probably damaging	Het
Kcnq3	A	G	15: 65,995,410	S795P	probably damaging	Het
Lhx8	G	T	3: 154,330,288	A22E	probably benign	Het
Lrp8	A	G	4: 107,806,809		probably benign	Het
Lvrn	G	T	18: 46,893,701	A789S	probably damaging	Het
Lvrn	T	C	18: 46,881,412	S526P	probably damaging	Het
Mga	T	A	2: 119,964,054	C2622S	possibly damaging	Het
Mroh8	T	C	2: 157,228,727	E568G	probably benign	Het
Ms4a4b	C	A	19: 11,463,139		probably benign	Het
Muc2	T	C	7: 141,749,543	F99S	probably benign	Het
Myo5c	T	A	9: 75,273,543	I738N	probably damaging	Het
Naip6	A	C	13: 100,296,969	V1120G	probably damaging	Het
Ncl	T	C	1: 86,356,179	T307A	probably benign	Het
Npr1	A	T	3: 90,455,965	D869E	possibly damaging	Het
Nup93	A	G	8: 94,286,603	T36A	probably benign	Het
Olfml2b	C	A	1: 170,662,378	T189N	probably damaging	Het
Olfr1255	A	G	2: 89,816,968	N208S	possibly damaging	Het
Olfr877	T	C	9: 37,855,312	F165L	probably benign	Het
P4htm	A	C	9: 108,579,228	W458G	probably damaging	Het
Pdzrn4	G	T	15: 92,770,757	R930L	probably damaging	Het
Pgam5	G	A	5: 110,260,435	A240V	probably damaging	Het
Prex2	T	C	1: 11,149,905		probably benign	Het
Ptpru	T	G	4: 131,788,382	E897A	probably damaging	Het
Rapgef2	A	T	3: 79,074,363	N1256K	probably benign	Het
Rhbdl3	A	G	11: 80,319,613	E64G	probably benign	Het
Siah1a	G	T	8: 86,725,075	D260E	probably benign	Het
Skint6	T	C	4: 113,067,470	I522V	probably benign	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Smok3c	T	C	5: 138,064,551	I100T	probably damaging	Het
Snx24	C	A	18: 53,385,223	Y141*	probably null	Het
Tigit	A	G	16: 43,649,231	S166P	probably damaging	Het
Tmem183a	C	T	1: 134,348,166	R324Q	probably benign	Het
Tmie	T	C	9: 110,866,933	D130G	possibly damaging	Het
Uggt1	G	A	1: 36,202,855	R333*	probably null	Het
Vmn2r111	T	C	17: 22,548,656	N620S	possibly damaging	Het
Vmn2r12	T	A	5: 109,092,986	N87I	probably damaging	Het
Vmn2r92	A	G	17: 18,184,343	D583G	probably benign	Het
Zdhhc17	T	C	10: 110,985,958	D60G	possibly damaging	Het

Other mutations in Sel1l3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01152:Sel1l3	APN	5	53116333	missense	probably damaging	0.96
IGL01585:Sel1l3	APN	5	53154236	missense	probably damaging	0.99
IGL01717:Sel1l3	APN	5	53200168	missense	probably damaging	0.99
IGL01771:Sel1l3	APN	5	53121841	missense	probably damaging	0.99
IGL01926:Sel1l3	APN	5	53200143	missense	probably benign	0.26
IGL01963:Sel1l3	APN	5	53200338	missense	probably damaging	0.99
IGL02000:Sel1l3	APN	5	53145493	missense	probably damaging	1.00
IGL02132:Sel1l3	APN	5	53170405	missense	possibly damaging	0.89
IGL02198:Sel1l3	APN	5	53139799	splice site	probably benign
IGL02930:Sel1l3	APN	5	53123217	missense	possibly damaging	0.65
IGL03146:Sel1l3	APN	5	53154243	missense	probably benign	0.00
IGL03175:Sel1l3	APN	5	53121857	missense	probably damaging	1.00
R0083:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0108:Sel1l3	UTSW	5	53137902	missense	possibly damaging	0.79
R0940:Sel1l3	UTSW	5	53144037	splice site	probably benign
R1027:Sel1l3	UTSW	5	53145478	missense	possibly damaging	0.68
R1117:Sel1l3	UTSW	5	53172607	missense	probably benign	0.00
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1145:Sel1l3	UTSW	5	53131827	missense	probably damaging	0.99
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1146:Sel1l3	UTSW	5	53117103	missense	possibly damaging	0.79
R1345:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1370:Sel1l3	UTSW	5	53200217	missense	possibly damaging	0.86
R1503:Sel1l3	UTSW	5	53137929	missense	probably damaging	0.98
R1747:Sel1l3	UTSW	5	53145545	missense	possibly damaging	0.91
R1764:Sel1l3	UTSW	5	53170447	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R2872:Sel1l3	UTSW	5	53137883	nonsense	probably null
R3434:Sel1l3	UTSW	5	53117090	missense	probably benign	0.44
R4043:Sel1l3	UTSW	5	53188054	nonsense	probably null
R4074:Sel1l3	UTSW	5	53154287	missense	probably damaging	0.99
R4727:Sel1l3	UTSW	5	53144183	critical splice acceptor site	probably null
R4788:Sel1l3	UTSW	5	53131833	missense	probably benign	0.41
R5000:Sel1l3	UTSW	5	53200434	missense	probably damaging	0.97
R5090:Sel1l3	UTSW	5	53200046	missense	probably benign	0.03
R5330:Sel1l3	UTSW	5	53186009	missense	possibly damaging	0.80
R5456:Sel1l3	UTSW	5	53200036	missense	probably benign	0.13
R5544:Sel1l3	UTSW	5	53200302	missense	probably damaging	0.98
R5848:Sel1l3	UTSW	5	53184808	missense	possibly damaging	0.91
R6132:Sel1l3	UTSW	5	53200189	missense	possibly damaging	0.77
R6188:Sel1l3	UTSW	5	53155719	missense	possibly damaging	0.70
R6622:Sel1l3	UTSW	5	53139860	missense	probably damaging	0.98
R7015:Sel1l3	UTSW	5	53172574	missense	probably benign	0.03
R7200:Sel1l3	UTSW	5	53144109	missense	probably benign	0.22
R7271:Sel1l3	UTSW	5	53116362	missense	probably damaging	0.98
R7378:Sel1l3	UTSW	5	53116409	missense	probably benign	0.02
R7479:Sel1l3	UTSW	5	53117120	missense	probably damaging	0.99
R7563:Sel1l3	UTSW	5	53185984	missense	probably damaging	1.00
R7643:Sel1l3	UTSW	5	53123162	splice site	probably null
R7741:Sel1l3	UTSW	5	53200251	missense	probably damaging	1.00
R7743:Sel1l3	UTSW	5	53135885	missense	probably benign	0.07
R7861:Sel1l3	UTSW	5	53144064	missense	probably damaging	0.96
R7904:Sel1l3	UTSW	5	53139824	missense	probably benign	0.24
R8222:Sel1l3	UTSW	5	53187954	critical splice donor site	probably null
R8724:Sel1l3	UTSW	5	53135823	nonsense	probably null
R8788:Sel1l3	UTSW	5	53174806	nonsense	probably null
R8988:Sel1l3	UTSW	5	53123429	missense	probably damaging	0.96
R9111:Sel1l3	UTSW	5	53121871	splice site	probably benign
R9153:Sel1l3	UTSW	5	53135846	missense	probably benign	0.26
R9269:Sel1l3	UTSW	5	53154286	missense	probably damaging	1.00
R9399:Sel1l3	UTSW	5	53108144	missense	probably benign
R9455:Sel1l3	UTSW	5	53131815	missense	probably damaging	0.99
R9630:Sel1l3	UTSW	5	53184775	missense	possibly damaging	0.49
R9793:Sel1l3	UTSW	5	53172582	missense	probably benign	0.02
R9795:Sel1l3	UTSW	5	53172582	missense	probably benign	0.02
Z1088:Sel1l3	UTSW	5	53116196	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- TACTGGGAGGCTGTGATTTCCC -3'
(R):5'- ACGAGAGCTCTCAAAATGCATTC -3'

Sequencing Primer
(F):5'- AGGCTGTGATTTCCCTGTAAATTGC -3'
(R):5'- GAGCTCTCAAAATGCATTCTCTTTAC -3'

Posted On

2016-03-17