Mutagenetix > Incidental Mutation

Incidental Mutation 'R4900:Muc2'

376088

Institutional Source

Beutler Lab

Gene Symbol

Muc2

Ensembl Gene

ENSMUSG00000025515

Gene Name

mucin 2

Synonyms

2010015E03Rik

MMRRC Submission

042504-MU

Accession Numbers

Genbank: BC034197; MGI: 1339364

Essential gene?

Probably non essential (E-score: 0.094) question?

Stock #

R4900 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

141690340-141754693 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 141749543 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Serine at position 99 (F99S)

Ref Sequence

ENSEMBL: ENSMUSP00000026590 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026590]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000026590
AA Change: F99S

PolyPhen 2 Score 0.323 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000026590
Gene: ENSMUSG00000025515
AA Change: F99S

Domain	Start	End	E-Value	Type
C8	1	63	1.65e-11	SMART
VWC	120	188	5.48e-2	SMART
VWC	229	293	2.38e-11	SMART
Blast:VWD	299	363	4e-17	BLAST
CT	380	463	3.6e-35	SMART

Predicted Effect

unknown
Transcript: ENSMUST00000187945
AA Change: F538S

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.1%

Validation Efficiency

100% (84/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the mucin protein family. Mucins are high molecular weight glycoproteins produced by many epithelial tissues. The protein encoded by this gene is secreted and forms an insoluble mucous barrier that protects the gut lumen. The protein polymerizes into a gel of which 80% is composed of oligosaccharide side chains by weight. The protein features a central domain containing tandem repeats rich in threonine and proline that varies between 50 and 115 copies in different individuals. Downregulation of this gene has been observed in patients with Crohn disease and ulcerative colitis. [provided by RefSeq, Oct 2016]
PHENOTYPE: Homozygotes for a point mutation have soft feces at weaning and develop diarrhea associated with malapsorption syndrome. Homozygous null mutants pass blood in their feces at 6 months, and 65% of null mutants have intestinal tumors at 1 year. [provided by MGI curators]

Allele List at MGI

All alleles(7) : Targeted(3) Chemically induced(4)

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930590J08Rik	T	C	6: 91,918,110	V262A	probably benign	Het
Abtb2	A	G	2: 103,567,004	E93G	possibly damaging	Het
Adam5	A	C	8: 24,742,156		probably null	Het
Adam5	G	A	8: 24,781,603	T596I	probably damaging	Het
Adgrb2	T	A	4: 130,013,875	Y1001N	probably damaging	Het
Aox2	T	G	1: 58,305,385	S546A	probably benign	Het
Asic2	T	C	11: 81,573,454		probably benign	Het
Bcl11b	T	A	12: 107,989,698	N64I	probably damaging	Het
Cacna1g	A	G	11: 94,459,351	F556S	possibly damaging	Het
Cbl	A	G	9: 44,152,869	V790A	probably benign	Het
Cd300c2	A	T	11: 115,000,981	C22*	probably null	Het
Cdh11	C	T	8: 102,647,458		probably null	Het
Ces2g	C	T	8: 104,967,357	Q442*	probably null	Het
Cps1	A	T	1: 67,160,904	T404S	probably damaging	Het
Csf2rb2	A	T	15: 78,285,974		probably null	Het
Csmd2	A	G	4: 128,452,525	Y1526C	probably benign	Het
Cyp2a12	C	T	7: 27,031,215	Q202*	probably null	Het
Cyp2c39	G	A	19: 39,513,576	M136I	probably benign	Het
Cyp2j13	G	A	4: 96,059,043	T257I	probably damaging	Het
Dnah8	T	A	17: 30,746,975	L2427Q	probably damaging	Het
Dopey2	G	T	16: 93,763,430		probably null	Het
Epcam	T	C	17: 87,643,621	V212A	possibly damaging	Het
Fam189a2	A	G	19: 23,975,426	S507P	possibly damaging	Het
Flt1	C	A	5: 147,683,939	A132S	probably benign	Het
Flvcr2	T	A	12: 85,782,982	V255D	probably damaging	Het
Galc	G	T	12: 98,231,472	T326K	probably damaging	Het
Gas2l3	CACTCGTCATACT	CACT	10: 89,430,958		probably benign	Het
Gen1	A	T	12: 11,241,560	Y808N	probably benign	Het
Glis1	C	T	4: 107,619,564	A306V	probably damaging	Het
Gm10638	A	G	8: 86,746,400		probably benign	Het
Gm12789	G	A	4: 101,988,985		probably benign	Het
Gm1966	T	G	7: 106,598,586		noncoding transcript	Het
Gm27048	C	T	8: 80,934,599		noncoding transcript	Het
Gm4204	T	C	1: 135,232,818		noncoding transcript	Het
Gm904	A	T	13: 50,645,289	I95F	possibly damaging	Het
Hjurp	GT	GTT	1: 88,266,524		probably null	Het
Ints11	G	A	4: 155,888,430	D526N	probably benign	Het
Itfg2	A	G	6: 128,416,316		probably benign	Het
Jund	T	C	8: 70,699,605	V183A	probably damaging	Het
Kcnj8	A	G	6: 142,566,495	S129P	probably damaging	Het
Kcnq3	A	G	15: 65,995,410	S795P	probably damaging	Het
Lhx8	G	T	3: 154,330,288	A22E	probably benign	Het
Lrp8	A	G	4: 107,806,809		probably benign	Het
Lvrn	G	T	18: 46,893,701	A789S	probably damaging	Het
Lvrn	T	C	18: 46,881,412	S526P	probably damaging	Het
Mga	T	A	2: 119,964,054	C2622S	possibly damaging	Het
Mroh8	T	C	2: 157,228,727	E568G	probably benign	Het
Ms4a4b	C	A	19: 11,463,139		probably benign	Het
Myo5c	T	A	9: 75,273,543	I738N	probably damaging	Het
Naip6	A	C	13: 100,296,969	V1120G	probably damaging	Het
Ncl	T	C	1: 86,356,179	T307A	probably benign	Het
Npr1	A	T	3: 90,455,965	D869E	possibly damaging	Het
Nup93	A	G	8: 94,286,603	T36A	probably benign	Het
Olfml2b	C	A	1: 170,662,378	T189N	probably damaging	Het
Olfr1255	A	G	2: 89,816,968	N208S	possibly damaging	Het
Olfr877	T	C	9: 37,855,312	F165L	probably benign	Het
P4htm	A	C	9: 108,579,228	W458G	probably damaging	Het
Pdzrn4	G	T	15: 92,770,757	R930L	probably damaging	Het
Pgam5	G	A	5: 110,260,435	A240V	probably damaging	Het
Prex2	T	C	1: 11,149,905		probably benign	Het
Ptpru	T	G	4: 131,788,382	E897A	probably damaging	Het
Rapgef2	A	T	3: 79,074,363	N1256K	probably benign	Het
Rhbdl3	A	G	11: 80,319,613	E64G	probably benign	Het
Sel1l3	A	T	5: 53,131,842	L879Q	probably damaging	Het
Siah1a	G	T	8: 86,725,075	D260E	probably benign	Het
Skint6	T	C	4: 113,067,470	I522V	probably benign	Het
Slco4c1	G	A	1: 96,841,228	P303L	probably damaging	Het
Smok3c	T	C	5: 138,064,551	I100T	probably damaging	Het
Snx24	C	A	18: 53,385,223	Y141*	probably null	Het
Tigit	A	G	16: 43,649,231	S166P	probably damaging	Het
Tmem183a	C	T	1: 134,348,166	R324Q	probably benign	Het
Tmie	T	C	9: 110,866,933	D130G	possibly damaging	Het
Uggt1	G	A	1: 36,202,855	R333*	probably null	Het
Vmn2r111	T	C	17: 22,548,656	N620S	possibly damaging	Het
Vmn2r12	T	A	5: 109,092,986	N87I	probably damaging	Het
Vmn2r92	A	G	17: 18,184,343	D583G	probably benign	Het
Zdhhc17	T	C	10: 110,985,958	D60G	possibly damaging	Het

Other mutations in Muc2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
Eeyore	APN	7	141693356	missense	probably benign	0.35
kenny	APN	7		nonsense
Winnie	APN	7	141699460	missense	probably damaging	1.00
IGL01303:Muc2	APN	7	141752395	missense	probably benign
IGL01482:Muc2	APN	7	141754060	missense	probably damaging	0.96
IGL01875:Muc2	APN	7	141752740	missense	probably damaging	0.99
IGL02088:Muc2	APN	7	141751504	missense	probably damaging	1.00
IGL02415:Muc2	APN	7	141751872	nonsense	probably null
IGL02548:Muc2	APN	7	141751857	missense	probably damaging	1.00
IGL02836:Muc2	APN	7	141746713	unclassified	probably benign
IGL03196:Muc2	APN	7	141747630	missense	probably damaging	0.97
Muskatenwein	UTSW	7	141753439	missense	unknown
nomoco	UTSW	7	141753719	missense	probably damaging	1.00
Schlendrian	UTSW	7	141695682	missense	probably damaging	1.00
Seco	UTSW	7	141698733	missense	probably damaging	1.00
BB001:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
BB011:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
E0370:Muc2	UTSW	7	141696355	missense	probably damaging	1.00
R0127:Muc2	UTSW	7	141748954	missense	probably benign	0.00
R0179:Muc2	UTSW	7	141748971	missense	probably damaging	1.00
R0201:Muc2	UTSW	7	141699185	frame shift	probably null
R0299:Muc2	UTSW	7	141752729	missense	probably damaging	1.00
R0547:Muc2	UTSW	7	141699185	frame shift	probably null
R0699:Muc2	UTSW	7	141752300	missense	probably damaging	1.00
R0900:Muc2	UTSW	7	141699185	frame shift	probably null
R1348:Muc2	UTSW	7	141699185	frame shift	probably null
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1466:Muc2	UTSW	7	141748974	missense	probably damaging	1.00
R1625:Muc2	UTSW	7	141697162	missense	probably damaging	1.00
R2010:Muc2	UTSW	7	141700875	missense	probably damaging	0.99
R2149:Muc2	UTSW	7	141699185	frame shift	probably null
R2163:Muc2	UTSW	7	141699185	frame shift	probably null
R3008:Muc2	UTSW	7	141695104	missense	possibly damaging	0.93
R3110:Muc2	UTSW	7	141745488	unclassified	probably benign
R3112:Muc2	UTSW	7	141745488	unclassified	probably benign
R3424:Muc2	UTSW	7	141693352	missense	probably damaging	0.99
R3786:Muc2	UTSW	7	141697347	missense	probably benign	0.01
R3854:Muc2	UTSW	7	141754344	missense	probably damaging	1.00
R3964:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3965:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3966:Muc2	UTSW	7	141699664	missense	probably benign	0.17
R3973:Muc2	UTSW	7	141746804	unclassified	probably benign
R3974:Muc2	UTSW	7	141746804	unclassified	probably benign
R3976:Muc2	UTSW	7	141746804	unclassified	probably benign
R4327:Muc2	UTSW	7	141695334	missense	probably damaging	0.96
R4694:Muc2	UTSW	7	141752345	missense	probably damaging	1.00
R4764:Muc2	UTSW	7	141745608	missense	possibly damaging	0.88
R4769:Muc2	UTSW	7	141699691	critical splice donor site	probably null
R4798:Muc2	UTSW	7	141754140	missense	probably benign	0.01
R5383:Muc2	UTSW	7	141753719	missense	probably damaging	1.00
R5489:Muc2	UTSW	7	141751432	missense	probably benign	0.00
R5615:Muc2	UTSW	7	141691203	missense	probably damaging	1.00
R5856:Muc2	UTSW	7	141745644	unclassified	probably benign
R5919:Muc2	UTSW	7	141694928	missense	probably damaging	0.97
R5953:Muc2	UTSW	7	141701382	missense	probably damaging	0.96
R5979:Muc2	UTSW	7	141697250	splice site	probably null
R5979:Muc2	UTSW	7	141751406	missense	probably damaging	0.99
R6175:Muc2	UTSW	7	141696632	missense	probably damaging	1.00
R6213:Muc2	UTSW	7	141751414	missense	probably damaging	1.00
R6281:Muc2	UTSW	7	141752403	missense	probably damaging	1.00
R6321:Muc2	UTSW	7	141700828	missense	probably benign	0.28
R6390:Muc2	UTSW	7	141752146	missense	probably damaging	0.97
R6485:Muc2	UTSW	7	141746736	unclassified	probably benign
R6582:Muc2	UTSW	7	141696698	missense	probably benign	0.00
R6683:Muc2	UTSW	7	141751477	missense	probably benign	0.38
R6896:Muc2	UTSW	7	141752695	missense	possibly damaging	0.48
R6906:Muc2	UTSW	7	141698733	missense	probably damaging	1.00
R6924:Muc2	UTSW	7	141697834	missense	possibly damaging	0.87
R7040:Muc2	UTSW	7	141751457	missense	unknown
R7222:Muc2	UTSW	7	141704209	missense
R7251:Muc2	UTSW	7	141692722	missense	possibly damaging	0.91
R7282:Muc2	UTSW	7	141752744	missense
R7315:Muc2	UTSW	7	141690402	missense	probably damaging	0.99
R7421:Muc2	UTSW	7	141748126	missense
R7556:Muc2	UTSW	7	141753702	missense
R7651:Muc2	UTSW	7	141704201	missense
R7710:Muc2	UTSW	7	141700883	missense	possibly damaging	0.92
R7776:Muc2	UTSW	7	141704393	missense
R7813:Muc2	UTSW	7	141696300	splice site	probably null
R7843:Muc2	UTSW	7	141695419	missense	probably benign	0.03
R7869:Muc2	UTSW	7	141749734	missense
R7924:Muc2	UTSW	7	141695388	missense	probably damaging	1.00
R7993:Muc2	UTSW	7	141754436	missense
R8053:Muc2	UTSW	7	141698332	missense	probably benign	0.01
R8068:Muc2	UTSW	7	141744685	missense
R8099:Muc2	UTSW	7	141745438	splice site	probably null
R8192:Muc2	UTSW	7	141751478	missense
R8194:Muc2	UTSW	7	141704252	missense
R8545:Muc2	UTSW	7	141752393	missense	unknown
R8701:Muc2	UTSW	7	141695607	missense	probably damaging	1.00
R8883:Muc2	UTSW	7	141700900	missense	probably damaging	0.98
R8894:Muc2	UTSW	7	141694515	missense	probably damaging	1.00
R8905:Muc2	UTSW	7	141693400	missense	probably benign	0.00
R9024:Muc2	UTSW	7	141701367	missense	probably damaging	0.98
R9032:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9085:Muc2	UTSW	7	141700489	missense	probably damaging	1.00
R9091:Muc2	UTSW	7	141704267	missense
R9104:Muc2	UTSW	7	141699655	missense	probably damaging	1.00
R9114:Muc2	UTSW	7	141701414	nonsense	probably null
R9270:Muc2	UTSW	7	141704267	missense
R9297:Muc2	UTSW	7	141749022	missense
R9325:Muc2	UTSW	7	141744822	missense
R9354:Muc2	UTSW	7	141753420	missense
R9386:Muc2	UTSW	7	141693146	missense	probably damaging	1.00
R9529:Muc2	UTSW	7	141700884	missense	possibly damaging	0.55
R9550:Muc2	UTSW	7	141754505	missense	probably damaging	1.00
R9583:Muc2	UTSW	7	141746822	missense
R9607:Muc2	UTSW	7	141751453	missense
R9646:Muc2	UTSW	7	141690400	missense	probably benign
R9651:Muc2	UTSW	7	141701445	missense	probably damaging	0.99
R9774:Muc2	UTSW	7	141699242	missense	probably benign
R9784:Muc2	UTSW	7	141694542	nonsense	probably null
Z1176:Muc2	UTSW	7	141746714	missense
Z1177:Muc2	UTSW	7	141744794	missense

Predicted Primers

PCR Primer
(F):5'- TGTGGCCCTGAAGAAGAACC -3'
(R):5'- TTGTCAGGTCCCACACATCCTAG -3'

Sequencing Primer
(F):5'- CCTGCCAGCCCAGGTATG -3'
(R):5'- GGTCCCACACATCCTAGAAAGAGAG -3'

Posted On

2016-03-17