Incidental Mutation 'R4900:Cbl'
ID376099
Institutional Source Beutler Lab
Gene Symbol Cbl
Ensembl Gene ENSMUSG00000034342
Gene NameCasitas B-lineage lymphoma
SynonymsCbl-2, c-Cbl
MMRRC Submission 042504-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.807) question?
Stock #R4900 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location44142976-44234049 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 44152869 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 790 (V790A)
Ref Sequence ENSEMBL: ENSMUSP00000146244 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037644] [ENSMUST00000205968] [ENSMUST00000206147] [ENSMUST00000206720]
Predicted Effect probably benign
Transcript: ENSMUST00000037644
AA Change: V746A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000041902
Gene: ENSMUSG00000034342
AA Change: V746A

DomainStartEndE-ValueType
low complexity region 8 23 N/A INTRINSIC
low complexity region 34 46 N/A INTRINSIC
Pfam:Cbl_N 49 173 9.4e-59 PFAM
Pfam:Cbl_N2 177 260 4.7e-44 PFAM
Pfam:Cbl_N3 262 347 7.2e-48 PFAM
RING 379 417 1.04e-7 SMART
low complexity region 454 463 N/A INTRINSIC
low complexity region 530 549 N/A INTRINSIC
UBA 864 901 3.17e-8 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205313
Predicted Effect probably benign
Transcript: ENSMUST00000205968
AA Change: V773A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206125
Predicted Effect probably benign
Transcript: ENSMUST00000206147
AA Change: V790A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206258
Predicted Effect probably benign
Transcript: ENSMUST00000206720
AA Change: V790A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.0660 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (84/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a proto-oncogene that encodes a RING finger E3 ubiquitin ligase. The encoded protein is one of the enzymes required for targeting substrates for degradation by the proteasome. This protein mediates the transfer of ubiquitin from ubiquitin conjugating enzymes (E2) to specific substrates. This protein also contains an N-terminal phosphotyrosine binding domain that allows it to interact with numerous tyrosine-phosphorylated substrates and target them for proteasome degradation. As such it functions as a negative regulator of many signal transduction pathways. This gene has been found to be mutated or translocated in many cancers including acute myeloid leukaemia, and expansion of CGG repeats in the 5' UTR has been associated with Jacobsen syndrome. Mutations in this gene are also the cause of Noonan syndrome-like disorder. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations exhibit increased thymic CD3 and CD4 expression and tyrosine-phosphorylation, lymphoid hyperplasia, and altered splenic hemopoiesis. Females show increased ductal density and branching in mammary fat pads. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,918,110 V262A probably benign Het
Abtb2 A G 2: 103,567,004 E93G possibly damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Adgrb2 T A 4: 130,013,875 Y1001N probably damaging Het
Aox2 T G 1: 58,305,385 S546A probably benign Het
Asic2 T C 11: 81,573,454 probably benign Het
Bcl11b T A 12: 107,989,698 N64I probably damaging Het
Cacna1g A G 11: 94,459,351 F556S possibly damaging Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdh11 C T 8: 102,647,458 probably null Het
Ces2g C T 8: 104,967,357 Q442* probably null Het
Cps1 A T 1: 67,160,904 T404S probably damaging Het
Csf2rb2 A T 15: 78,285,974 probably null Het
Csmd2 A G 4: 128,452,525 Y1526C probably benign Het
Cyp2a12 C T 7: 27,031,215 Q202* probably null Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Cyp2j13 G A 4: 96,059,043 T257I probably damaging Het
Dnah8 T A 17: 30,746,975 L2427Q probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Fam189a2 A G 19: 23,975,426 S507P possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Flvcr2 T A 12: 85,782,982 V255D probably damaging Het
Galc G T 12: 98,231,472 T326K probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gen1 A T 12: 11,241,560 Y808N probably benign Het
Glis1 C T 4: 107,619,564 A306V probably damaging Het
Gm10638 A G 8: 86,746,400 probably benign Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gm1966 T G 7: 106,598,586 noncoding transcript Het
Gm27048 C T 8: 80,934,599 noncoding transcript Het
Gm4204 T C 1: 135,232,818 noncoding transcript Het
Gm904 A T 13: 50,645,289 I95F possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ints11 G A 4: 155,888,430 D526N probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Kcnj8 A G 6: 142,566,495 S129P probably damaging Het
Kcnq3 A G 15: 65,995,410 S795P probably damaging Het
Lhx8 G T 3: 154,330,288 A22E probably benign Het
Lrp8 A G 4: 107,806,809 probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Lvrn T C 18: 46,881,412 S526P probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mroh8 T C 2: 157,228,727 E568G probably benign Het
Ms4a4b C A 19: 11,463,139 probably benign Het
Muc2 T C 7: 141,749,543 F99S probably benign Het
Myo5c T A 9: 75,273,543 I738N probably damaging Het
Naip6 A C 13: 100,296,969 V1120G probably damaging Het
Ncl T C 1: 86,356,179 T307A probably benign Het
Npr1 A T 3: 90,455,965 D869E possibly damaging Het
Nup93 A G 8: 94,286,603 T36A probably benign Het
Olfml2b C A 1: 170,662,378 T189N probably damaging Het
Olfr1255 A G 2: 89,816,968 N208S possibly damaging Het
Olfr877 T C 9: 37,855,312 F165L probably benign Het
P4htm A C 9: 108,579,228 W458G probably damaging Het
Pdzrn4 G T 15: 92,770,757 R930L probably damaging Het
Pgam5 G A 5: 110,260,435 A240V probably damaging Het
Prex2 T C 1: 11,149,905 probably benign Het
Ptpru T G 4: 131,788,382 E897A probably damaging Het
Rapgef2 A T 3: 79,074,363 N1256K probably benign Het
Rhbdl3 A G 11: 80,319,613 E64G probably benign Het
Sel1l3 A T 5: 53,131,842 L879Q probably damaging Het
Siah1a G T 8: 86,725,075 D260E probably benign Het
Skint6 T C 4: 113,067,470 I522V probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Smok3c T C 5: 138,064,551 I100T probably damaging Het
Snx24 C A 18: 53,385,223 Y141* probably null Het
Tigit A G 16: 43,649,231 S166P probably damaging Het
Tmem183a C T 1: 134,348,166 R324Q probably benign Het
Tmie T C 9: 110,866,933 D130G possibly damaging Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Vmn2r111 T C 17: 22,548,656 N620S possibly damaging Het
Vmn2r12 T A 5: 109,092,986 N87I probably damaging Het
Vmn2r92 A G 17: 18,184,343 D583G probably benign Het
Zdhhc17 T C 10: 110,985,958 D60G possibly damaging Het
Other mutations in Cbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00590:Cbl APN 9 44201198 missense probably damaging 1.00
IGL01369:Cbl APN 9 44201061 nonsense probably null
IGL01434:Cbl APN 9 44164206 missense probably damaging 0.99
IGL01866:Cbl APN 9 44153825 nonsense probably null
IGL02326:Cbl APN 9 44151473 missense possibly damaging 0.94
IGL02956:Cbl APN 9 44169034 missense probably damaging 1.00
Bungalow UTSW 9 44201119 missense probably damaging 1.00
Casita UTSW 9 44164165 missense probably damaging 1.00
tiny_house UTSW 9 44164152 missense probably damaging 1.00
R0068:Cbl UTSW 9 44154194 missense probably damaging 0.98
R0390:Cbl UTSW 9 44201005 missense probably damaging 1.00
R0655:Cbl UTSW 9 44158752 missense probably damaging 1.00
R0764:Cbl UTSW 9 44164152 missense probably damaging 1.00
R1466:Cbl UTSW 9 44154244 missense probably benign 0.10
R1466:Cbl UTSW 9 44154244 missense probably benign 0.10
R1616:Cbl UTSW 9 44152900 missense probably damaging 0.99
R1736:Cbl UTSW 9 44152895 missense possibly damaging 0.80
R1808:Cbl UTSW 9 44164229 missense probably damaging 1.00
R1865:Cbl UTSW 9 44164165 missense probably damaging 1.00
R3156:Cbl UTSW 9 44158850 missense possibly damaging 0.74
R3431:Cbl UTSW 9 44151446 makesense probably null
R4668:Cbl UTSW 9 44153848 missense probably benign 0.00
R4700:Cbl UTSW 9 44173380 missense probably damaging 1.00
R4866:Cbl UTSW 9 44152869 missense probably benign 0.00
R4995:Cbl UTSW 9 44153811 missense possibly damaging 0.62
R5014:Cbl UTSW 9 44154399 intron probably null
R5324:Cbl UTSW 9 44154254 missense probably damaging 0.97
R5353:Cbl UTSW 9 44173323 missense probably damaging 1.00
R5382:Cbl UTSW 9 44159021 missense probably benign
R5747:Cbl UTSW 9 44201119 missense probably damaging 1.00
R5834:Cbl UTSW 9 44233779 missense probably damaging 1.00
R6307:Cbl UTSW 9 44158512 critical splice donor site probably null
R6755:Cbl UTSW 9 44173374 missense probably damaging 0.98
R7393:Cbl UTSW 9 44154188 critical splice donor site probably null
R7779:Cbl UTSW 9 44159096 missense probably benign
R7789:Cbl UTSW 9 44163467 missense probably damaging 1.00
X0057:Cbl UTSW 9 44233767 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- CAGCTTTCCAACATATAGATCCAGG -3'
(R):5'- GCTGCCTCTGGATTGAAGTG -3'

Sequencing Primer
(F):5'- CTACTCACTGACTTATTGACACGAG -3'
(R):5'- CCTCTGGATTGAAGTGTGTTGGAAAG -3'
Posted On2016-03-17