Incidental Mutation 'R4900:Fam189a2'
ID376128
Institutional Source Beutler Lab
Gene Symbol Fam189a2
Ensembl Gene ENSMUSG00000071604
Gene Namefamily with sequence similarity 189, member A2
SynonymsLOC381217
MMRRC Submission 042504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R4900 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location23972751-24031019 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23975426 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 507 (S507P)
Ref Sequence ENSEMBL: ENSMUSP00000093878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096164]
Predicted Effect possibly damaging
Transcript: ENSMUST00000096164
AA Change: S507P

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000093878
Gene: ENSMUSG00000071604
AA Change: S507P

DomainStartEndE-ValueType
Pfam:CD20 91 254 9.5e-33 PFAM
low complexity region 282 294 N/A INTRINSIC
low complexity region 404 417 N/A INTRINSIC
low complexity region 455 469 N/A INTRINSIC
low complexity region 567 584 N/A INTRINSIC
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.1%
Validation Efficiency 100% (84/84)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930590J08Rik T C 6: 91,918,110 V262A probably benign Het
Abtb2 A G 2: 103,567,004 E93G possibly damaging Het
Adam5 A C 8: 24,742,156 probably null Het
Adam5 G A 8: 24,781,603 T596I probably damaging Het
Adgrb2 T A 4: 130,013,875 Y1001N probably damaging Het
Aox2 T G 1: 58,305,385 S546A probably benign Het
Asic2 T C 11: 81,573,454 probably benign Het
Bcl11b T A 12: 107,989,698 N64I probably damaging Het
Cacna1g A G 11: 94,459,351 F556S possibly damaging Het
Cbl A G 9: 44,152,869 V790A probably benign Het
Cd300c2 A T 11: 115,000,981 C22* probably null Het
Cdh11 C T 8: 102,647,458 probably null Het
Ces2g C T 8: 104,967,357 Q442* probably null Het
Cps1 A T 1: 67,160,904 T404S probably damaging Het
Csf2rb2 A T 15: 78,285,974 probably null Het
Csmd2 A G 4: 128,452,525 Y1526C probably benign Het
Cyp2a12 C T 7: 27,031,215 Q202* probably null Het
Cyp2c39 G A 19: 39,513,576 M136I probably benign Het
Cyp2j13 G A 4: 96,059,043 T257I probably damaging Het
Dnah8 T A 17: 30,746,975 L2427Q probably damaging Het
Dopey2 G T 16: 93,763,430 probably null Het
Epcam T C 17: 87,643,621 V212A possibly damaging Het
Flt1 C A 5: 147,683,939 A132S probably benign Het
Flvcr2 T A 12: 85,782,982 V255D probably damaging Het
Galc G T 12: 98,231,472 T326K probably damaging Het
Gas2l3 CACTCGTCATACT CACT 10: 89,430,958 probably benign Het
Gen1 A T 12: 11,241,560 Y808N probably benign Het
Glis1 C T 4: 107,619,564 A306V probably damaging Het
Gm10638 A G 8: 86,746,400 probably benign Het
Gm12789 G A 4: 101,988,985 probably benign Het
Gm1966 T G 7: 106,598,586 noncoding transcript Het
Gm27048 C T 8: 80,934,599 noncoding transcript Het
Gm4204 T C 1: 135,232,818 noncoding transcript Het
Gm904 A T 13: 50,645,289 I95F possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Ints11 G A 4: 155,888,430 D526N probably benign Het
Itfg2 A G 6: 128,416,316 probably benign Het
Jund T C 8: 70,699,605 V183A probably damaging Het
Kcnj8 A G 6: 142,566,495 S129P probably damaging Het
Kcnq3 A G 15: 65,995,410 S795P probably damaging Het
Lhx8 G T 3: 154,330,288 A22E probably benign Het
Lrp8 A G 4: 107,806,809 probably benign Het
Lvrn G T 18: 46,893,701 A789S probably damaging Het
Lvrn T C 18: 46,881,412 S526P probably damaging Het
Mga T A 2: 119,964,054 C2622S possibly damaging Het
Mroh8 T C 2: 157,228,727 E568G probably benign Het
Ms4a4b C A 19: 11,463,139 probably benign Het
Muc2 T C 7: 141,749,543 F99S probably benign Het
Myo5c T A 9: 75,273,543 I738N probably damaging Het
Naip6 A C 13: 100,296,969 V1120G probably damaging Het
Ncl T C 1: 86,356,179 T307A probably benign Het
Npr1 A T 3: 90,455,965 D869E possibly damaging Het
Nup93 A G 8: 94,286,603 T36A probably benign Het
Olfml2b C A 1: 170,662,378 T189N probably damaging Het
Olfr1255 A G 2: 89,816,968 N208S possibly damaging Het
Olfr877 T C 9: 37,855,312 F165L probably benign Het
P4htm A C 9: 108,579,228 W458G probably damaging Het
Pdzrn4 G T 15: 92,770,757 R930L probably damaging Het
Pgam5 G A 5: 110,260,435 A240V probably damaging Het
Prex2 T C 1: 11,149,905 probably benign Het
Ptpru T G 4: 131,788,382 E897A probably damaging Het
Rapgef2 A T 3: 79,074,363 N1256K probably benign Het
Rhbdl3 A G 11: 80,319,613 E64G probably benign Het
Sel1l3 A T 5: 53,131,842 L879Q probably damaging Het
Siah1a G T 8: 86,725,075 D260E probably benign Het
Skint6 T C 4: 113,067,470 I522V probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Smok3c T C 5: 138,064,551 I100T probably damaging Het
Snx24 C A 18: 53,385,223 Y141* probably null Het
Tigit A G 16: 43,649,231 S166P probably damaging Het
Tmem183a C T 1: 134,348,166 R324Q probably benign Het
Tmie T C 9: 110,866,933 D130G possibly damaging Het
Uggt1 G A 1: 36,202,855 R333* probably null Het
Vmn2r111 T C 17: 22,548,656 N620S possibly damaging Het
Vmn2r12 T A 5: 109,092,986 N87I probably damaging Het
Vmn2r92 A G 17: 18,184,343 D583G probably benign Het
Zdhhc17 T C 10: 110,985,958 D60G possibly damaging Het
Other mutations in Fam189a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Fam189a2 APN 19 23984722 missense probably damaging 1.00
IGL03162:Fam189a2 APN 19 23988460 missense probably damaging 1.00
R0285:Fam189a2 UTSW 19 23979385 splice site probably benign
R0613:Fam189a2 UTSW 19 23986489 missense probably damaging 1.00
R1078:Fam189a2 UTSW 19 23973575 missense probably benign 0.01
R1122:Fam189a2 UTSW 19 23975392 missense probably damaging 1.00
R1228:Fam189a2 UTSW 19 23979465 missense probably benign 0.00
R1445:Fam189a2 UTSW 19 24021634 missense probably damaging 1.00
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1469:Fam189a2 UTSW 19 23973606 missense probably benign 0.01
R1547:Fam189a2 UTSW 19 23979701 missense probably damaging 1.00
R1657:Fam189a2 UTSW 19 23975635 missense probably damaging 1.00
R1710:Fam189a2 UTSW 19 23979695 missense probably damaging 1.00
R3701:Fam189a2 UTSW 19 23979467 missense probably benign 0.00
R4163:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4163:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4164:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975629 missense probably damaging 1.00
R4303:Fam189a2 UTSW 19 23975638 missense probably damaging 1.00
R4418:Fam189a2 UTSW 19 23979435 missense probably benign
R4558:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4559:Fam189a2 UTSW 19 24030549 missense probably damaging 0.99
R4866:Fam189a2 UTSW 19 23975426 missense possibly damaging 0.64
R4879:Fam189a2 UTSW 19 23975655 critical splice acceptor site probably null
R4934:Fam189a2 UTSW 19 23973425 makesense probably null
R5530:Fam189a2 UTSW 19 23975594 missense probably benign 0.01
R5942:Fam189a2 UTSW 19 23986470 missense probably damaging 1.00
R6041:Fam189a2 UTSW 19 23984829 missense probably benign 0.41
R6207:Fam189a2 UTSW 19 23973438 missense probably damaging 1.00
R6572:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R6573:Fam189a2 UTSW 19 23988502 missense probably damaging 1.00
R6711:Fam189a2 UTSW 19 23978099 missense probably benign 0.02
R6952:Fam189a2 UTSW 19 23984718 missense possibly damaging 0.78
R7621:Fam189a2 UTSW 19 23994804 missense possibly damaging 0.68
R7968:Fam189a2 UTSW 19 23984727 missense probably damaging 1.00
X0018:Fam189a2 UTSW 19 23975646 frame shift probably null
X0020:Fam189a2 UTSW 19 23975646 frame shift probably null
X0027:Fam189a2 UTSW 19 23975646 frame shift probably null
X0065:Fam189a2 UTSW 19 23975646 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTCCCTTGGGTCAAGAGCAC -3'
(R):5'- CTCGCTACAGTGACTCTGAG -3'

Sequencing Primer
(F):5'- CAGAAAGAAAGCTCTCTAGTTTCCTC -3'
(R):5'- CTCTGAGGAGAGGCGCGAG -3'
Posted On2016-03-17