Incidental Mutation 'R4901:Slc27a4'
ID376133
Institutional Source Beutler Lab
Gene Symbol Slc27a4
Ensembl Gene ENSMUSG00000059316
Gene Namesolute carrier family 27 (fatty acid transporter), member 4
SynonymsFATP4, fatty acid transport protein 4
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4901 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location29802634-29817522 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 29812636 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 516 (V516A)
Ref Sequence ENSEMBL: ENSMUSP00000078971 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080065]
Predicted Effect probably damaging
Transcript: ENSMUST00000080065
AA Change: V516A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078971
Gene: ENSMUSG00000059316
AA Change: V516A

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:AMP-binding 80 512 1.2e-72 PFAM
Pfam:AMP-binding_C 520 595 2.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136444
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of fatty acid transport proteins, which are involved in translocation of long-chain fatty acids cross the plasma membrane. This protein is expressed at high levels on the apical side of mature enterocytes in the small intestine, and appears to be the principal fatty acid transporter in enterocytes. Clinical studies suggest this gene as a candidate gene for the insulin resistance syndrome. Mutations in this gene have been associated with ichthyosis prematurity syndrome. [provided by RefSeq, Apr 2010]
PHENOTYPE: Homozygous mutant mice are not viable. While mice of one mutant line die during early development, mice of other mutant lines die at birth exhibiting abnormal skin. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 C T 9: 44,277,657 probably null Het
Arg2 T C 12: 79,147,711 V103A probably damaging Het
Bicra T A 7: 15,987,601 T664S possibly damaging Het
Bptf A T 11: 107,110,860 Y475* probably null Het
Calcrl T C 2: 84,333,513 I445V probably benign Het
Ccdc110 G A 8: 45,943,400 R776Q probably benign Het
Ccnc A G 4: 21,727,894 N4S probably damaging Het
Ccni G A 5: 93,183,144 R323W probably damaging Het
Celsr2 T A 3: 108,406,987 M1241L possibly damaging Het
Cpd T C 11: 76,790,881 I1145M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2j8 T A 4: 96,479,086 D265V probably benign Het
Dennd2a T C 6: 39,522,687 T315A probably benign Het
Dgkz T A 2: 91,936,731 Q905L probably benign Het
Dnah8 G A 17: 30,840,714 probably null Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Gm12166 A G 11: 46,051,829 S156P probably damaging Het
Gm136 G A 4: 34,746,580 Q144* probably null Het
Gm5415 T C 1: 32,546,620 S70G probably benign Het
Gon4l T C 3: 88,908,151 V2008A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Isyna1 A T 8: 70,596,596 H414L probably damaging Het
Kif20b A G 19: 34,934,436 Y233C probably benign Het
Klk1 A T 7: 44,228,715 I132F probably damaging Het
Klre1 A T 6: 129,584,225 H183L probably benign Het
Lrp1b T C 2: 40,821,645 T3188A probably damaging Het
Mapk12 A T 15: 89,134,638 L198* probably null Het
Mt4 A C 8: 94,138,284 T29P possibly damaging Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Nr1h4 T C 10: 89,478,797 Q269R possibly damaging Het
Olfr1198 C G 2: 88,746,887 probably null Het
Olfr558 A G 7: 102,710,198 H313R probably benign Het
Pde1b A G 15: 103,526,685 I421V probably null Het
Pde3b A T 7: 114,508,190 T519S probably damaging Het
Phf21a T A 2: 92,357,001 C178* probably null Het
Phtf2 A G 5: 20,805,724 S88P possibly damaging Het
Pik3c3 A G 18: 30,302,929 M394V possibly damaging Het
Plxnb1 C T 9: 109,104,959 P752S probably benign Het
Pp2d1 C A 17: 53,515,009 G343V probably benign Het
Ppp6r2 A G 15: 89,259,069 I140V possibly damaging Het
Ppp6r3 C A 19: 3,467,229 V75L probably damaging Het
Ptprq T A 10: 107,688,414 H486L probably benign Het
Rasgrf1 C T 9: 89,995,003 T807M probably benign Het
Rasgrp3 C A 17: 75,514,116 Y439* probably null Het
Rbm44 A G 1: 91,153,328 T413A probably benign Het
Rnf135 T C 11: 80,198,836 C333R probably damaging Het
Scfd2 A G 5: 74,519,565 V309A probably damaging Het
Serpina3m A T 12: 104,389,649 K192* probably null Het
Sh3tc2 A G 18: 61,990,435 I756V probably benign Het
Sult2a5 T A 7: 13,625,263 C55S probably benign Het
Tarsl2 C T 7: 65,691,294 T783M probably benign Het
Tet2 A T 3: 133,467,044 I1819N possibly damaging Het
Timeless T C 10: 128,250,762 F1057L probably damaging Het
Ttn T A 2: 76,798,074 I12835F probably damaging Het
Uhrf1 T A 17: 56,310,834 D185E probably benign Het
Vmn2r74 G T 7: 85,955,991 S483* probably null Het
Xpo1 A T 11: 23,281,327 I304F possibly damaging Het
Zc3h11a A G 1: 133,624,711 S553P probably benign Het
Zdhhc1 A G 8: 105,472,852 S402P probably benign Het
Zwilch T C 9: 64,162,746 Y101C probably damaging Het
Other mutations in Slc27a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01132:Slc27a4 APN 2 29804302 missense probably benign 0.03
IGL01982:Slc27a4 APN 2 29812615 missense probably damaging 1.00
IGL02160:Slc27a4 APN 2 29805962 missense probably benign 0.04
IGL02290:Slc27a4 APN 2 29815729 missense probably damaging 1.00
IGL02382:Slc27a4 APN 2 29809843 missense probably damaging 1.00
IGL02738:Slc27a4 APN 2 29811226 missense probably benign 0.15
R0470:Slc27a4 UTSW 2 29804185 missense probably benign 0.10
R0688:Slc27a4 UTSW 2 29812615 missense probably damaging 1.00
R0847:Slc27a4 UTSW 2 29811249 missense probably benign 0.20
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1466:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1584:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
R1793:Slc27a4 UTSW 2 29805721 missense probably benign 0.00
R1804:Slc27a4 UTSW 2 29811267 missense probably benign 0.01
R2056:Slc27a4 UTSW 2 29810941 missense probably damaging 0.99
R5601:Slc27a4 UTSW 2 29805660 missense probably benign 0.30
R5663:Slc27a4 UTSW 2 29812370 missense probably damaging 1.00
R5934:Slc27a4 UTSW 2 29811660 missense probably damaging 0.96
R6196:Slc27a4 UTSW 2 29805750 missense probably benign 0.00
R6643:Slc27a4 UTSW 2 29812848 missense probably benign 0.01
R7033:Slc27a4 UTSW 2 29804271 missense possibly damaging 0.94
R7176:Slc27a4 UTSW 2 29811226 missense probably benign 0.15
R7179:Slc27a4 UTSW 2 29815652 nonsense probably null
R7192:Slc27a4 UTSW 2 29805929 missense probably damaging 1.00
R7301:Slc27a4 UTSW 2 29812932 missense probably null 0.99
R7500:Slc27a4 UTSW 2 29812705 missense probably damaging 0.99
R7810:Slc27a4 UTSW 2 29805710 missense probably benign 0.25
R8042:Slc27a4 UTSW 2 29811190 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AATGAGAGCTTCCAGTCTCAGAG -3'
(R):5'- AGGTCACAGTTGCTGATGGG -3'

Sequencing Primer
(F):5'- GAGAGCTTCCAGTCTCAGAGAACAC -3'
(R):5'- CAGTTGCTGATGGGACTTGCAAC -3'
Posted On2016-03-17