Incidental Mutation 'R4901:Ccni'
ID376149
Institutional Source Beutler Lab
Gene Symbol Ccni
Ensembl Gene ENSMUSG00000063015
Gene Namecyclin I
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4901 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location93181933-93206495 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 93183144 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 323 (R323W)
Ref Sequence ENSEMBL: ENSMUSP00000050189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058550] [ENSMUST00000151568] [ENSMUST00000201823]
Predicted Effect probably damaging
Transcript: ENSMUST00000058550
AA Change: R323W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000050189
Gene: ENSMUSG00000063015
AA Change: R323W

DomainStartEndE-ValueType
CYCLIN 50 136 1.18e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123033
Predicted Effect probably benign
Transcript: ENSMUST00000151568
SMART Domains Protein: ENSMUSP00000116224
Gene: ENSMUSG00000063015

DomainStartEndE-ValueType
CYCLIN 50 136 1.18e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201581
Predicted Effect probably benign
Transcript: ENSMUST00000201823
SMART Domains Protein: ENSMUSP00000143972
Gene: ENSMUSG00000063015

DomainStartEndE-ValueType
CYCLIN 3 89 7.4e-19 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202150
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin shows the highest similarity with cyclin G. The transcript of this gene was found to be expressed constantly during cell cycle progression. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile and do not display any gross physical or behavioral abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 C T 9: 44,277,657 probably null Het
Arg2 T C 12: 79,147,711 V103A probably damaging Het
Bicra T A 7: 15,987,601 T664S possibly damaging Het
Bptf A T 11: 107,110,860 Y475* probably null Het
Calcrl T C 2: 84,333,513 I445V probably benign Het
Ccdc110 G A 8: 45,943,400 R776Q probably benign Het
Ccnc A G 4: 21,727,894 N4S probably damaging Het
Celsr2 T A 3: 108,406,987 M1241L possibly damaging Het
Cpd T C 11: 76,790,881 I1145M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2j8 T A 4: 96,479,086 D265V probably benign Het
Dennd2a T C 6: 39,522,687 T315A probably benign Het
Dgkz T A 2: 91,936,731 Q905L probably benign Het
Dnah8 G A 17: 30,840,714 probably null Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Gm12166 A G 11: 46,051,829 S156P probably damaging Het
Gm136 G A 4: 34,746,580 Q144* probably null Het
Gm5415 T C 1: 32,546,620 S70G probably benign Het
Gon4l T C 3: 88,908,151 V2008A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Isyna1 A T 8: 70,596,596 H414L probably damaging Het
Kif20b A G 19: 34,934,436 Y233C probably benign Het
Klk1 A T 7: 44,228,715 I132F probably damaging Het
Klre1 A T 6: 129,584,225 H183L probably benign Het
Lrp1b T C 2: 40,821,645 T3188A probably damaging Het
Mapk12 A T 15: 89,134,638 L198* probably null Het
Mt4 A C 8: 94,138,284 T29P possibly damaging Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Nr1h4 T C 10: 89,478,797 Q269R possibly damaging Het
Olfr1198 C G 2: 88,746,887 probably null Het
Olfr558 A G 7: 102,710,198 H313R probably benign Het
Pde1b A G 15: 103,526,685 I421V probably null Het
Pde3b A T 7: 114,508,190 T519S probably damaging Het
Phf21a T A 2: 92,357,001 C178* probably null Het
Phtf2 A G 5: 20,805,724 S88P possibly damaging Het
Pik3c3 A G 18: 30,302,929 M394V possibly damaging Het
Plxnb1 C T 9: 109,104,959 P752S probably benign Het
Pp2d1 C A 17: 53,515,009 G343V probably benign Het
Ppp6r2 A G 15: 89,259,069 I140V possibly damaging Het
Ppp6r3 C A 19: 3,467,229 V75L probably damaging Het
Ptprq T A 10: 107,688,414 H486L probably benign Het
Rasgrf1 C T 9: 89,995,003 T807M probably benign Het
Rasgrp3 C A 17: 75,514,116 Y439* probably null Het
Rbm44 A G 1: 91,153,328 T413A probably benign Het
Rnf135 T C 11: 80,198,836 C333R probably damaging Het
Scfd2 A G 5: 74,519,565 V309A probably damaging Het
Serpina3m A T 12: 104,389,649 K192* probably null Het
Sh3tc2 A G 18: 61,990,435 I756V probably benign Het
Slc27a4 T C 2: 29,812,636 V516A probably damaging Het
Sult2a5 T A 7: 13,625,263 C55S probably benign Het
Tarsl2 C T 7: 65,691,294 T783M probably benign Het
Tet2 A T 3: 133,467,044 I1819N possibly damaging Het
Timeless T C 10: 128,250,762 F1057L probably damaging Het
Ttn T A 2: 76,798,074 I12835F probably damaging Het
Uhrf1 T A 17: 56,310,834 D185E probably benign Het
Vmn2r74 G T 7: 85,955,991 S483* probably null Het
Xpo1 A T 11: 23,281,327 I304F possibly damaging Het
Zc3h11a A G 1: 133,624,711 S553P probably benign Het
Zdhhc1 A G 8: 105,472,852 S402P probably benign Het
Zwilch T C 9: 64,162,746 Y101C probably damaging Het
Other mutations in Ccni
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02301:Ccni APN 5 93188175 missense possibly damaging 0.77
IGL02545:Ccni APN 5 93187777 missense probably benign 0.01
IGL02865:Ccni APN 5 93183336 missense probably benign 0.04
R0234:Ccni UTSW 5 93202327 missense probably benign 0.02
R0234:Ccni UTSW 5 93202327 missense probably benign 0.02
R0541:Ccni UTSW 5 93187704 missense probably benign 0.00
R0718:Ccni UTSW 5 93202316 missense probably benign 0.00
R0760:Ccni UTSW 5 93183329 missense possibly damaging 0.89
R1656:Ccni UTSW 5 93188074 splice site probably null
R1752:Ccni UTSW 5 93202456 start gained probably benign
R1817:Ccni UTSW 5 93188108 missense possibly damaging 0.89
R3551:Ccni UTSW 5 93187761 missense probably benign 0.05
R3552:Ccni UTSW 5 93187761 missense probably benign 0.05
R3956:Ccni UTSW 5 93183404 missense probably damaging 1.00
R4809:Ccni UTSW 5 93187570 intron probably benign
R4937:Ccni UTSW 5 93188254 splice site probably null
R4975:Ccni UTSW 5 93187694 missense possibly damaging 0.83
R7120:Ccni UTSW 5 93183331 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ACAGCCTTCCCTGGGTTTCTAG -3'
(R):5'- ACACCCTGGTAACCTGTGAC -3'

Sequencing Primer
(F):5'- TAGTCTCACCCCGAGTAGTCAG -3'
(R):5'- CCCTGGTAACCTGTGACAAAGG -3'
Posted On2016-03-17