Incidental Mutation 'R4901:Zwilch'
ID376167
Institutional Source Beutler Lab
Gene Symbol Zwilch
Ensembl Gene ENSMUSG00000032400
Gene Namezwilch kinetochore protein
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4901 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location64137144-64173104 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 64162746 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 101 (Y101C)
Ref Sequence ENSEMBL: ENSMUSP00000135328 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122091] [ENSMUST00000130127] [ENSMUST00000176299] [ENSMUST00000176378] [ENSMUST00000176794] [ENSMUST00000177045]
Predicted Effect probably damaging
Transcript: ENSMUST00000122091
AA Change: Y120C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000112790
Gene: ENSMUSG00000032400
AA Change: Y120C

DomainStartEndE-ValueType
Pfam:DUF2352 38 589 6e-206 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124301
SMART Domains Protein: ENSMUSP00000134966
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 3e-31 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000130127
AA Change: Y78C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116187
Gene: ENSMUSG00000032400
AA Change: Y78C

DomainStartEndE-ValueType
Pfam:DUF2352 72 154 8e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000176299
SMART Domains Protein: ENSMUSP00000135585
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
Pfam:DUF2352 1 471 2.9e-192 PFAM
Predicted Effect silent
Transcript: ENSMUST00000176378
SMART Domains Protein: ENSMUSP00000134782
Gene: ENSMUSG00000032400

DomainStartEndE-ValueType
PDB:3IF8|A 3 74 1e-31 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000176794
AA Change: Y120C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134850
Gene: ENSMUSG00000032400
AA Change: Y120C

DomainStartEndE-ValueType
Pfam:DUF2352 38 257 8e-67 PFAM
Pfam:DUF2352 254 568 4.4e-131 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000177045
AA Change: Y101C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135328
Gene: ENSMUSG00000032400
AA Change: Y101C

DomainStartEndE-ValueType
Pfam:DUF2352 19 303 2.2e-93 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 C T 9: 44,277,657 probably null Het
Arg2 T C 12: 79,147,711 V103A probably damaging Het
Bicra T A 7: 15,987,601 T664S possibly damaging Het
Bptf A T 11: 107,110,860 Y475* probably null Het
Calcrl T C 2: 84,333,513 I445V probably benign Het
Ccdc110 G A 8: 45,943,400 R776Q probably benign Het
Ccnc A G 4: 21,727,894 N4S probably damaging Het
Ccni G A 5: 93,183,144 R323W probably damaging Het
Celsr2 T A 3: 108,406,987 M1241L possibly damaging Het
Cpd T C 11: 76,790,881 I1145M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2j8 T A 4: 96,479,086 D265V probably benign Het
Dennd2a T C 6: 39,522,687 T315A probably benign Het
Dgkz T A 2: 91,936,731 Q905L probably benign Het
Dnah8 G A 17: 30,840,714 probably null Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Gm12166 A G 11: 46,051,829 S156P probably damaging Het
Gm136 G A 4: 34,746,580 Q144* probably null Het
Gm5415 T C 1: 32,546,620 S70G probably benign Het
Gon4l T C 3: 88,908,151 V2008A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Isyna1 A T 8: 70,596,596 H414L probably damaging Het
Kif20b A G 19: 34,934,436 Y233C probably benign Het
Klk1 A T 7: 44,228,715 I132F probably damaging Het
Klre1 A T 6: 129,584,225 H183L probably benign Het
Lrp1b T C 2: 40,821,645 T3188A probably damaging Het
Mapk12 A T 15: 89,134,638 L198* probably null Het
Mt4 A C 8: 94,138,284 T29P possibly damaging Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Nr1h4 T C 10: 89,478,797 Q269R possibly damaging Het
Olfr1198 C G 2: 88,746,887 probably null Het
Olfr558 A G 7: 102,710,198 H313R probably benign Het
Pde1b A G 15: 103,526,685 I421V probably null Het
Pde3b A T 7: 114,508,190 T519S probably damaging Het
Phf21a T A 2: 92,357,001 C178* probably null Het
Phtf2 A G 5: 20,805,724 S88P possibly damaging Het
Pik3c3 A G 18: 30,302,929 M394V possibly damaging Het
Plxnb1 C T 9: 109,104,959 P752S probably benign Het
Pp2d1 C A 17: 53,515,009 G343V probably benign Het
Ppp6r2 A G 15: 89,259,069 I140V possibly damaging Het
Ppp6r3 C A 19: 3,467,229 V75L probably damaging Het
Ptprq T A 10: 107,688,414 H486L probably benign Het
Rasgrf1 C T 9: 89,995,003 T807M probably benign Het
Rasgrp3 C A 17: 75,514,116 Y439* probably null Het
Rbm44 A G 1: 91,153,328 T413A probably benign Het
Rnf135 T C 11: 80,198,836 C333R probably damaging Het
Scfd2 A G 5: 74,519,565 V309A probably damaging Het
Serpina3m A T 12: 104,389,649 K192* probably null Het
Sh3tc2 A G 18: 61,990,435 I756V probably benign Het
Slc27a4 T C 2: 29,812,636 V516A probably damaging Het
Sult2a5 T A 7: 13,625,263 C55S probably benign Het
Tarsl2 C T 7: 65,691,294 T783M probably benign Het
Tet2 A T 3: 133,467,044 I1819N possibly damaging Het
Timeless T C 10: 128,250,762 F1057L probably damaging Het
Ttn T A 2: 76,798,074 I12835F probably damaging Het
Uhrf1 T A 17: 56,310,834 D185E probably benign Het
Vmn2r74 G T 7: 85,955,991 S483* probably null Het
Xpo1 A T 11: 23,281,327 I304F possibly damaging Het
Zc3h11a A G 1: 133,624,711 S553P probably benign Het
Zdhhc1 A G 8: 105,472,852 S402P probably benign Het
Other mutations in Zwilch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02315:Zwilch APN 9 64150267 missense probably damaging 1.00
IGL02365:Zwilch APN 9 64160924 missense probably damaging 1.00
IGL02733:Zwilch APN 9 64146836 missense probably benign 0.12
IGL02818:Zwilch APN 9 64150227 missense probably damaging 0.99
R1171:Zwilch UTSW 9 64158717 missense possibly damaging 0.56
R1913:Zwilch UTSW 9 64160952 missense probably damaging 1.00
R2079:Zwilch UTSW 9 64153574 missense probably damaging 1.00
R2079:Zwilch UTSW 9 64153575 missense probably damaging 1.00
R3772:Zwilch UTSW 9 64156034 missense probably benign 0.03
R4171:Zwilch UTSW 9 64158715 nonsense probably null
R4298:Zwilch UTSW 9 64155162 critical splice donor site probably null
R4299:Zwilch UTSW 9 64155162 critical splice donor site probably null
R5106:Zwilch UTSW 9 64153584 missense probably damaging 1.00
R5208:Zwilch UTSW 9 64152923 missense probably benign 0.00
R5215:Zwilch UTSW 9 64146874 missense probably benign
R5413:Zwilch UTSW 9 64168610 splice site probably null
R5865:Zwilch UTSW 9 64172908 start gained probably null
R6221:Zwilch UTSW 9 64161383 missense probably damaging 1.00
R6858:Zwilch UTSW 9 64153587 missense probably damaging 1.00
R6957:Zwilch UTSW 9 64162562 critical splice donor site probably null
R6995:Zwilch UTSW 9 64165449 nonsense probably null
R7104:Zwilch UTSW 9 64161376 missense probably damaging 1.00
R7691:Zwilch UTSW 9 64156091 missense probably benign 0.18
R7743:Zwilch UTSW 9 64152935 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGAGCACATACAGGATAACGCC -3'
(R):5'- CTGGTCTTCTGCAAGAGTAATGC -3'

Sequencing Primer
(F):5'- GATAACGCCTGCAATGATGTC -3'
(R):5'- CTGCTAAAACATCTCTCTAGACTTG -3'
Posted On2016-03-17