Incidental Mutation 'R4901:Arg2'
ID376178
Institutional Source Beutler Lab
Gene Symbol Arg2
Ensembl Gene ENSMUSG00000021125
Gene Namearginase type II
SynonymsAII
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4901 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location79130777-79156301 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 79147711 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 103 (V103A)
Ref Sequence ENSEMBL: ENSMUSP00000021550 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021550]
Predicted Effect probably damaging
Transcript: ENSMUST00000021550
AA Change: V103A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000021550
Gene: ENSMUSG00000021125
AA Change: V103A

DomainStartEndE-ValueType
Pfam:Arginase 24 324 7.4e-80 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218917
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Arginase catalyzes the hydrolysis of arginine to ornithine and urea. At least two isoforms of mammalian arginase exists (types I and II) which differ in their tissue distribution, subcellular localization, immunologic crossreactivity and physiologic function. The type II isoform encoded by this gene, is located in the mitochondria and expressed in extra-hepatic tissues, especially kidney. The physiologic role of this isoform is poorly understood; it is thought to play a role in nitric oxide and polyamine metabolism. Transcript variants of the type II gene resulting from the use of alternative polyadenylation sites have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene results in elevated plasma arginine concentrations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 C T 9: 44,277,657 probably null Het
Bicra T A 7: 15,987,601 T664S possibly damaging Het
Bptf A T 11: 107,110,860 Y475* probably null Het
Calcrl T C 2: 84,333,513 I445V probably benign Het
Ccdc110 G A 8: 45,943,400 R776Q probably benign Het
Ccnc A G 4: 21,727,894 N4S probably damaging Het
Ccni G A 5: 93,183,144 R323W probably damaging Het
Celsr2 T A 3: 108,406,987 M1241L possibly damaging Het
Cpd T C 11: 76,790,881 I1145M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2j8 T A 4: 96,479,086 D265V probably benign Het
Dennd2a T C 6: 39,522,687 T315A probably benign Het
Dgkz T A 2: 91,936,731 Q905L probably benign Het
Dnah8 G A 17: 30,840,714 probably null Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Gm12166 A G 11: 46,051,829 S156P probably damaging Het
Gm136 G A 4: 34,746,580 Q144* probably null Het
Gm5415 T C 1: 32,546,620 S70G probably benign Het
Gon4l T C 3: 88,908,151 V2008A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Isyna1 A T 8: 70,596,596 H414L probably damaging Het
Kif20b A G 19: 34,934,436 Y233C probably benign Het
Klk1 A T 7: 44,228,715 I132F probably damaging Het
Klre1 A T 6: 129,584,225 H183L probably benign Het
Lrp1b T C 2: 40,821,645 T3188A probably damaging Het
Mapk12 A T 15: 89,134,638 L198* probably null Het
Mt4 A C 8: 94,138,284 T29P possibly damaging Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Nr1h4 T C 10: 89,478,797 Q269R possibly damaging Het
Olfr1198 C G 2: 88,746,887 probably null Het
Olfr558 A G 7: 102,710,198 H313R probably benign Het
Pde1b A G 15: 103,526,685 I421V probably null Het
Pde3b A T 7: 114,508,190 T519S probably damaging Het
Phf21a T A 2: 92,357,001 C178* probably null Het
Phtf2 A G 5: 20,805,724 S88P possibly damaging Het
Pik3c3 A G 18: 30,302,929 M394V possibly damaging Het
Plxnb1 C T 9: 109,104,959 P752S probably benign Het
Pp2d1 C A 17: 53,515,009 G343V probably benign Het
Ppp6r2 A G 15: 89,259,069 I140V possibly damaging Het
Ppp6r3 C A 19: 3,467,229 V75L probably damaging Het
Ptprq T A 10: 107,688,414 H486L probably benign Het
Rasgrf1 C T 9: 89,995,003 T807M probably benign Het
Rasgrp3 C A 17: 75,514,116 Y439* probably null Het
Rbm44 A G 1: 91,153,328 T413A probably benign Het
Rnf135 T C 11: 80,198,836 C333R probably damaging Het
Scfd2 A G 5: 74,519,565 V309A probably damaging Het
Serpina3m A T 12: 104,389,649 K192* probably null Het
Sh3tc2 A G 18: 61,990,435 I756V probably benign Het
Slc27a4 T C 2: 29,812,636 V516A probably damaging Het
Sult2a5 T A 7: 13,625,263 C55S probably benign Het
Tarsl2 C T 7: 65,691,294 T783M probably benign Het
Tet2 A T 3: 133,467,044 I1819N possibly damaging Het
Timeless T C 10: 128,250,762 F1057L probably damaging Het
Ttn T A 2: 76,798,074 I12835F probably damaging Het
Uhrf1 T A 17: 56,310,834 D185E probably benign Het
Vmn2r74 G T 7: 85,955,991 S483* probably null Het
Xpo1 A T 11: 23,281,327 I304F possibly damaging Het
Zc3h11a A G 1: 133,624,711 S553P probably benign Het
Zdhhc1 A G 8: 105,472,852 S402P probably benign Het
Zwilch T C 9: 64,162,746 Y101C probably damaging Het
Other mutations in Arg2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01546:Arg2 APN 12 79149859 splice site probably benign
IGL02494:Arg2 APN 12 79151923 missense probably benign 0.00
IGL02512:Arg2 APN 12 79147743 missense probably benign 0.01
IGL02543:Arg2 APN 12 79150759 missense probably benign 0.02
IGL02974:Arg2 APN 12 79150792 missense probably damaging 1.00
IGL03106:Arg2 APN 12 79149891 missense probably damaging 0.99
IGL03240:Arg2 APN 12 79131831 splice site probably null
R0119:Arg2 UTSW 12 79147612 missense probably damaging 1.00
R0136:Arg2 UTSW 12 79150006 missense probably damaging 1.00
R0299:Arg2 UTSW 12 79147612 missense probably damaging 1.00
R1856:Arg2 UTSW 12 79147662 missense probably benign
R1863:Arg2 UTSW 12 79150020 nonsense probably null
R4369:Arg2 UTSW 12 79149972 missense probably damaging 0.99
R7251:Arg2 UTSW 12 79150798 missense probably damaging 0.99
R8683:Arg2 UTSW 12 79150020 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CCAGTAGACGTTGGAATGGC -3'
(R):5'- TGGATCCTACCAGTTCTCCAAC -3'

Sequencing Primer
(F):5'- TGGCACAAATGGTTCATTCTG -3'
(R):5'- GCCAGATGAACGTCTTAAGAACCTTG -3'
Posted On2016-03-17