Incidental Mutation 'R4901:Pde1b'
ID376183
Institutional Source Beutler Lab
Gene Symbol Pde1b
Ensembl Gene ENSMUSG00000022489
Gene Namephosphodiesterase 1B, Ca2+-calmodulin dependent
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4901 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location103503034-103530052 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103526685 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 421 (I421V)
Ref Sequence ENSEMBL: ENSMUSP00000023132 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023132] [ENSMUST00000023133] [ENSMUST00000226468] [ENSMUST00000226493] [ENSMUST00000227955]
Predicted Effect probably null
Transcript: ENSMUST00000023132
AA Change: I421V

PolyPhen 2 Score 0.921 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000023132
Gene: ENSMUSG00000022489
AA Change: I421V

DomainStartEndE-ValueType
coiled coil region 38 60 N/A INTRINSIC
Pfam:PDEase_I_N 76 136 1.2e-33 PFAM
HDc 219 383 8.77e-5 SMART
Blast:HDc 394 443 1e-20 BLAST
low complexity region 467 478 N/A INTRINSIC
low complexity region 511 527 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000023133
SMART Domains Protein: ENSMUSP00000023133
Gene: ENSMUSG00000022490

DomainStartEndE-ValueType
Pfam:DARPP-32 2 165 2.2e-43 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000226468
AA Change: I421V

PolyPhen 2 Score 0.644 (Sensitivity: 0.87; Specificity: 0.91)
Predicted Effect probably null
Transcript: ENSMUST00000226493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227925
Predicted Effect probably null
Transcript: ENSMUST00000227955
AA Change: I402V

PolyPhen 2 Score 0.790 (Sensitivity: 0.85; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228813
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.4%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE1 subfamily. Members of the PDE1 family are calmodulin-dependent PDEs that are stimulated by a calcium-calmodulin complex. This PDE has dual-specificity for the second messengers, cAMP and cGMP, with a preference for cGMP as a substrate. cAMP and cGMP function as key regulators of many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jul 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display increased exploratory behavior. Learning deficits and hyperactivity are also observed in some situations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcg4 C T 9: 44,277,657 probably null Het
Arg2 T C 12: 79,147,711 V103A probably damaging Het
Bicra T A 7: 15,987,601 T664S possibly damaging Het
Bptf A T 11: 107,110,860 Y475* probably null Het
Calcrl T C 2: 84,333,513 I445V probably benign Het
Ccdc110 G A 8: 45,943,400 R776Q probably benign Het
Ccnc A G 4: 21,727,894 N4S probably damaging Het
Ccni G A 5: 93,183,144 R323W probably damaging Het
Celsr2 T A 3: 108,406,987 M1241L possibly damaging Het
Cpd T C 11: 76,790,881 I1145M probably damaging Het
Cybb C G X: 9,450,750 D246H probably benign Het
Cyp2j8 T A 4: 96,479,086 D265V probably benign Het
Dennd2a T C 6: 39,522,687 T315A probably benign Het
Dgkz T A 2: 91,936,731 Q905L probably benign Het
Dnah8 G A 17: 30,840,714 probably null Het
Elp2 A G 18: 24,619,485 H365R probably damaging Het
Gm12166 A G 11: 46,051,829 S156P probably damaging Het
Gm136 G A 4: 34,746,580 Q144* probably null Het
Gm5415 T C 1: 32,546,620 S70G probably benign Het
Gon4l T C 3: 88,908,151 V2008A possibly damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Isyna1 A T 8: 70,596,596 H414L probably damaging Het
Kif20b A G 19: 34,934,436 Y233C probably benign Het
Klk1 A T 7: 44,228,715 I132F probably damaging Het
Klre1 A T 6: 129,584,225 H183L probably benign Het
Lrp1b T C 2: 40,821,645 T3188A probably damaging Het
Mapk12 A T 15: 89,134,638 L198* probably null Het
Mt4 A C 8: 94,138,284 T29P possibly damaging Het
Myh14 C T 7: 44,661,040 V140I probably damaging Het
Nr1h4 T C 10: 89,478,797 Q269R possibly damaging Het
Olfr1198 C G 2: 88,746,887 probably null Het
Olfr558 A G 7: 102,710,198 H313R probably benign Het
Pde3b A T 7: 114,508,190 T519S probably damaging Het
Phf21a T A 2: 92,357,001 C178* probably null Het
Phtf2 A G 5: 20,805,724 S88P possibly damaging Het
Pik3c3 A G 18: 30,302,929 M394V possibly damaging Het
Plxnb1 C T 9: 109,104,959 P752S probably benign Het
Pp2d1 C A 17: 53,515,009 G343V probably benign Het
Ppp6r2 A G 15: 89,259,069 I140V possibly damaging Het
Ppp6r3 C A 19: 3,467,229 V75L probably damaging Het
Ptprq T A 10: 107,688,414 H486L probably benign Het
Rasgrf1 C T 9: 89,995,003 T807M probably benign Het
Rasgrp3 C A 17: 75,514,116 Y439* probably null Het
Rbm44 A G 1: 91,153,328 T413A probably benign Het
Rnf135 T C 11: 80,198,836 C333R probably damaging Het
Scfd2 A G 5: 74,519,565 V309A probably damaging Het
Serpina3m A T 12: 104,389,649 K192* probably null Het
Sh3tc2 A G 18: 61,990,435 I756V probably benign Het
Slc27a4 T C 2: 29,812,636 V516A probably damaging Het
Sult2a5 T A 7: 13,625,263 C55S probably benign Het
Tarsl2 C T 7: 65,691,294 T783M probably benign Het
Tet2 A T 3: 133,467,044 I1819N possibly damaging Het
Timeless T C 10: 128,250,762 F1057L probably damaging Het
Ttn T A 2: 76,798,074 I12835F probably damaging Het
Uhrf1 T A 17: 56,310,834 D185E probably benign Het
Vmn2r74 G T 7: 85,955,991 S483* probably null Het
Xpo1 A T 11: 23,281,327 I304F possibly damaging Het
Zc3h11a A G 1: 133,624,711 S553P probably benign Het
Zdhhc1 A G 8: 105,472,852 S402P probably benign Het
Zwilch T C 9: 64,162,746 Y101C probably damaging Het
Other mutations in Pde1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Pde1b APN 15 103526680 missense probably damaging 1.00
IGL01539:Pde1b APN 15 103525345 splice site probably benign
IGL01988:Pde1b APN 15 103524856 unclassified probably null
IGL02380:Pde1b APN 15 103519990 missense possibly damaging 0.80
IGL02424:Pde1b APN 15 103528219 splice site probably benign
IGL02710:Pde1b APN 15 103522057 missense probably damaging 1.00
R0111:Pde1b UTSW 15 103503513 missense probably benign
R1302:Pde1b UTSW 15 103527599 missense probably benign 0.12
R1312:Pde1b UTSW 15 103526273 missense possibly damaging 0.71
R1449:Pde1b UTSW 15 103525043 missense probably damaging 0.99
R1631:Pde1b UTSW 15 103521672 missense probably damaging 0.97
R1848:Pde1b UTSW 15 103525340 splice site probably null
R4032:Pde1b UTSW 15 103521326 missense probably damaging 1.00
R4896:Pde1b UTSW 15 103521374 missense probably damaging 1.00
R5052:Pde1b UTSW 15 103527648 missense possibly damaging 0.76
R5935:Pde1b UTSW 15 103521439 missense possibly damaging 0.81
R6117:Pde1b UTSW 15 103521482 missense probably damaging 0.99
R7092:Pde1b UTSW 15 103527031 missense probably benign 0.02
R7116:Pde1b UTSW 15 103528318 missense possibly damaging 0.82
R7270:Pde1b UTSW 15 103521655 missense possibly damaging 0.76
R7359:Pde1b UTSW 15 103521325 missense probably damaging 1.00
R7464:Pde1b UTSW 15 103524829 missense probably benign 0.05
R7980:Pde1b UTSW 15 103503589 splice site probably null
R8058:Pde1b UTSW 15 103524811 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGGATCCCATGCCTGTAAAG -3'
(R):5'- TGGGAACAACTTGGAGAGCC -3'

Sequencing Primer
(F):5'- GTAAAGTCTTTATCAGCCCAGC -3'
(R):5'- TGGAGAGCCCAGAAAGATCCTTC -3'
Posted On2016-03-17