Incidental Mutation 'R0282:Edrf1'
ID 37619
Institutional Source Beutler Lab
Gene Symbol Edrf1
Ensembl Gene ENSMUSG00000039990
Gene Name erythroid differentiation regulatory factor 1
Synonyms 2700050L05Rik
MMRRC Submission 038504-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.945) question?
Stock # R0282 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 133239422-133274710 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 133245751 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 223 (V223A)
Ref Sequence ENSEMBL: ENSMUSP00000059166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051169] [ENSMUST00000128901]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051169
AA Change: V223A

PolyPhen 2 Score 0.207 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000059166
Gene: ENSMUSG00000039990
AA Change: V223A

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 467 477 N/A INTRINSIC
low complexity region 529 549 N/A INTRINSIC
low complexity region 1171 1184 N/A INTRINSIC
low complexity region 1229 1237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128901
AA Change: V223A

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000115641
Gene: ENSMUSG00000039990
AA Change: V223A

DomainStartEndE-ValueType
low complexity region 8 29 N/A INTRINSIC
low complexity region 116 128 N/A INTRINSIC
low complexity region 219 237 N/A INTRINSIC
low complexity region 254 264 N/A INTRINSIC
low complexity region 433 443 N/A INTRINSIC
low complexity region 495 515 N/A INTRINSIC
low complexity region 1137 1150 N/A INTRINSIC
low complexity region 1195 1203 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154795
Meta Mutation Damage Score 0.0804 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (72/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene may play a role in erythroid cell differentiation. The encoded protein inhibits DNA binding of the erythroid transcription factor GATA-1 and may regulate the expression of alpha-globin and gamma-globin. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsbg3 T A 17: 57,192,169 (GRCm39) Y577* probably null Het
Afap1l2 A G 19: 56,904,653 (GRCm39) S549P possibly damaging Het
Alcam A T 16: 52,116,104 (GRCm39) C157S probably damaging Het
Aldh1a1 T C 19: 20,606,413 (GRCm39) probably benign Het
Ano8 G A 8: 71,933,258 (GRCm39) probably benign Het
Atr T C 9: 95,744,851 (GRCm39) V56A probably benign Het
Aurkc T A 7: 7,005,427 (GRCm39) probably null Het
Bnip3 T C 7: 138,499,759 (GRCm39) D76G probably damaging Het
Cbr1 A G 16: 93,407,022 (GRCm39) E246G possibly damaging Het
Ccdc157 G T 11: 4,096,708 (GRCm39) A449D probably damaging Het
Ces3b T A 8: 105,810,483 (GRCm39) V26D probably benign Het
Colgalt2 G T 1: 152,384,312 (GRCm39) A551S possibly damaging Het
Crk G T 11: 75,594,195 (GRCm39) G261C probably damaging Het
Ctbp1 A G 5: 33,408,200 (GRCm39) probably null Het
Ctnna1 G A 18: 35,377,175 (GRCm39) V572I possibly damaging Het
D430041D05Rik T C 2: 104,031,589 (GRCm39) Y1669C probably damaging Het
Dnah8 T C 17: 30,955,130 (GRCm39) F2053S probably damaging Het
Dner G A 1: 84,383,686 (GRCm39) T566M probably damaging Het
Dner A G 1: 84,423,101 (GRCm39) probably benign Het
Fam169a A G 13: 97,234,223 (GRCm39) probably benign Het
Fbxl3 G A 14: 103,332,661 (GRCm39) H106Y probably damaging Het
Fiz1 A G 7: 5,012,200 (GRCm39) V106A probably benign Het
Gapvd1 T A 2: 34,578,972 (GRCm39) R654* probably null Het
Gm7589 G A 9: 59,053,288 (GRCm39) noncoding transcript Het
Ifi202b A T 1: 173,804,926 (GRCm39) S9T probably benign Het
Ipmk G C 10: 71,208,661 (GRCm39) S149T probably benign Het
Irgm2 A G 11: 58,110,345 (GRCm39) E24G probably benign Het
Itga2b A C 11: 102,351,672 (GRCm39) V551G probably damaging Het
Itgad C T 7: 127,789,150 (GRCm39) probably benign Het
Kcnh8 T A 17: 53,032,879 (GRCm39) F55L probably damaging Het
Kdr G A 5: 76,110,760 (GRCm39) probably benign Het
Krt35 T C 11: 99,986,573 (GRCm39) Y147C probably damaging Het
Lamc1 A G 1: 153,131,058 (GRCm39) F298L probably benign Het
Lrrk2 T C 15: 91,662,617 (GRCm39) probably benign Het
Matn1 T C 4: 130,673,238 (GRCm39) S69P probably damaging Het
Micall1 G T 15: 79,016,101 (GRCm39) probably benign Het
Msto1 A G 3: 88,818,884 (GRCm39) V257A possibly damaging Het
Mybpc3 G C 2: 90,954,369 (GRCm39) probably benign Het
Mycn A G 12: 12,987,314 (GRCm39) V361A probably benign Het
Myo10 A G 15: 25,793,253 (GRCm39) T1277A probably damaging Het
Myo3a T C 2: 22,250,409 (GRCm39) I92T probably benign Het
Nup50l T C 6: 96,141,797 (GRCm39) T416A probably benign Het
Or10g1 A G 14: 52,647,720 (GRCm39) V203A possibly damaging Het
Or2k2 A G 4: 58,785,344 (GRCm39) I126T probably damaging Het
Or4c104 G A 2: 88,586,800 (GRCm39) T73I probably damaging Het
Or56b1b T A 7: 108,164,684 (GRCm39) Q106L probably damaging Het
Otog C T 7: 45,926,917 (GRCm39) T1222I possibly damaging Het
P4ha1 C T 10: 59,172,970 (GRCm39) T23M probably damaging Het
Pld1 A T 3: 28,132,422 (GRCm39) I537F probably benign Het
Plekhn1 A G 4: 156,312,780 (GRCm39) probably benign Het
Pxdn C A 12: 30,034,439 (GRCm39) S8* probably null Het
Rnf135 A T 11: 80,084,784 (GRCm39) I186F probably damaging Het
Rock2 T C 12: 17,027,887 (GRCm39) probably benign Het
Rph3a C A 5: 121,101,973 (GRCm39) G88* probably null Het
Sarm1 G A 11: 78,365,806 (GRCm39) Q740* probably null Het
Setd1b C A 5: 123,299,080 (GRCm39) probably benign Het
Sidt1 A G 16: 44,102,249 (GRCm39) S304P possibly damaging Het
Slc2a4 A T 11: 69,837,181 (GRCm39) V85E probably damaging Het
Swi5 A G 2: 32,170,766 (GRCm39) Y54H probably damaging Het
Sycp1 A G 3: 102,823,111 (GRCm39) probably benign Het
Tarm1 T C 7: 3,546,006 (GRCm39) Y87C probably damaging Het
Tmem67 G A 4: 12,087,930 (GRCm39) T72M probably damaging Het
Tor1a A G 2: 30,857,737 (GRCm39) Y44H possibly damaging Het
Ttll5 T C 12: 86,042,827 (GRCm39) Y1128H probably benign Het
Usp40 G A 1: 87,908,680 (GRCm39) probably benign Het
Vmn2r18 A T 5: 151,508,668 (GRCm39) M152K probably benign Het
Xirp2 T A 2: 67,343,724 (GRCm39) D1988E probably damaging Het
Zfp420 A G 7: 29,575,105 (GRCm39) I442V probably benign Het
Zyx A G 6: 42,332,939 (GRCm39) E363G probably damaging Het
Other mutations in Edrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01111:Edrf1 APN 7 133,260,282 (GRCm39) nonsense probably null
IGL01637:Edrf1 APN 7 133,252,254 (GRCm39) missense probably damaging 1.00
IGL01697:Edrf1 APN 7 133,245,459 (GRCm39) missense probably benign 0.02
IGL01893:Edrf1 APN 7 133,258,831 (GRCm39) missense probably benign 0.09
IGL02202:Edrf1 APN 7 133,258,699 (GRCm39) missense probably benign 0.00
IGL02278:Edrf1 APN 7 133,258,729 (GRCm39) missense probably benign 0.00
IGL02382:Edrf1 APN 7 133,252,344 (GRCm39) splice site probably benign
IGL02743:Edrf1 APN 7 133,258,220 (GRCm39) unclassified probably benign
R0265:Edrf1 UTSW 7 133,258,774 (GRCm39) missense probably damaging 1.00
R1167:Edrf1 UTSW 7 133,245,795 (GRCm39) missense probably benign 0.08
R1633:Edrf1 UTSW 7 133,253,869 (GRCm39) missense probably damaging 1.00
R2039:Edrf1 UTSW 7 133,255,678 (GRCm39) nonsense probably null
R2060:Edrf1 UTSW 7 133,258,858 (GRCm39) nonsense probably null
R2920:Edrf1 UTSW 7 133,269,301 (GRCm39) missense probably benign 0.00
R4770:Edrf1 UTSW 7 133,260,339 (GRCm39) missense probably damaging 0.99
R4887:Edrf1 UTSW 7 133,260,339 (GRCm39) missense probably damaging 0.99
R4888:Edrf1 UTSW 7 133,260,339 (GRCm39) missense probably damaging 0.99
R5135:Edrf1 UTSW 7 133,252,773 (GRCm39) missense probably benign 0.03
R5156:Edrf1 UTSW 7 133,261,908 (GRCm39) missense probably damaging 1.00
R5290:Edrf1 UTSW 7 133,252,295 (GRCm39) missense probably damaging 0.98
R5342:Edrf1 UTSW 7 133,253,639 (GRCm39) splice site probably null
R5416:Edrf1 UTSW 7 133,243,131 (GRCm39) missense possibly damaging 0.52
R5450:Edrf1 UTSW 7 133,260,339 (GRCm39) missense probably damaging 0.99
R5906:Edrf1 UTSW 7 133,265,144 (GRCm39) missense probably benign
R6272:Edrf1 UTSW 7 133,239,537 (GRCm39) start gained probably benign
R6275:Edrf1 UTSW 7 133,269,311 (GRCm39) missense possibly damaging 0.60
R7144:Edrf1 UTSW 7 133,239,578 (GRCm39) missense probably benign
R7244:Edrf1 UTSW 7 133,256,079 (GRCm39) missense probably benign 0.01
R7716:Edrf1 UTSW 7 133,245,455 (GRCm39) missense probably damaging 0.99
R8193:Edrf1 UTSW 7 133,263,606 (GRCm39) missense possibly damaging 0.95
R8197:Edrf1 UTSW 7 133,249,088 (GRCm39) missense probably benign 0.41
R8553:Edrf1 UTSW 7 133,252,047 (GRCm39) missense possibly damaging 0.88
R8710:Edrf1 UTSW 7 133,245,495 (GRCm39) missense probably damaging 1.00
R8839:Edrf1 UTSW 7 133,255,644 (GRCm39) missense probably benign 0.00
R9035:Edrf1 UTSW 7 133,245,431 (GRCm39) missense probably damaging 0.97
R9051:Edrf1 UTSW 7 133,273,207 (GRCm39) missense probably benign 0.00
R9121:Edrf1 UTSW 7 133,258,770 (GRCm39) frame shift probably null
R9396:Edrf1 UTSW 7 133,261,838 (GRCm39) missense possibly damaging 0.79
R9551:Edrf1 UTSW 7 133,240,742 (GRCm39) missense probably damaging 1.00
R9552:Edrf1 UTSW 7 133,240,742 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAGACTGGTGATTGGACATGGTTGAAA -3'
(R):5'- ACCCTGAGATGAGGCTGAGTGAAT -3'

Sequencing Primer
(F):5'- GGTATCAGAAGGCTATTCTTTCCAAG -3'
(R):5'- TGAGGCTGAGTGAATACCCC -3'
Posted On 2013-05-23