Incidental Mutation 'R0282:Ano8'
ID37621
Institutional Source Beutler Lab
Gene Symbol Ano8
Ensembl Gene ENSMUSG00000034863
Gene Nameanoctamin 8
SynonymsTmem16h
MMRRC Submission 038504-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0282 (G1)
Quality Score130
Status Validated
Chromosome8
Chromosomal Location71476019-71485963 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 71480614 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000123665 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093450] [ENSMUST00000124745] [ENSMUST00000138892] [ENSMUST00000147642] [ENSMUST00000213382]
Predicted Effect unknown
Transcript: ENSMUST00000093450
AA Change: A678V
SMART Domains Protein: ENSMUSP00000091157
Gene: ENSMUSG00000034863
AA Change: A678V

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
low complexity region 73 84 N/A INTRINSIC
Pfam:Anoctamin 237 874 3e-149 PFAM
coiled coil region 881 919 N/A INTRINSIC
low complexity region 948 964 N/A INTRINSIC
low complexity region 974 988 N/A INTRINSIC
low complexity region 1042 1056 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000124745
SMART Domains Protein: ENSMUSP00000121042
Gene: ENSMUSG00000074247

DomainStartEndE-ValueType
Pfam:DDA1 3 65 6e-34 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135052
Predicted Effect probably benign
Transcript: ENSMUST00000138892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146677
Predicted Effect probably benign
Transcript: ENSMUST00000147642
SMART Domains Protein: ENSMUSP00000123665
Gene: ENSMUSG00000074247

DomainStartEndE-ValueType
Pfam:DDA1 3 52 1.2e-23 PFAM
low complexity region 84 98 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212768
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213016
Predicted Effect unknown
Transcript: ENSMUST00000213382
AA Change: A722V
Meta Mutation Damage Score 0.1982 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.4%
  • 10x: 96.6%
  • 20x: 93.7%
Validation Efficiency 100% (72/72)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik T A 17: 56,885,169 Y577* probably null Het
1700123L14Rik T C 6: 96,164,816 T416A probably benign Het
Afap1l2 A G 19: 56,916,221 S549P possibly damaging Het
Alcam A T 16: 52,295,741 C157S probably damaging Het
Aldh1a1 T C 19: 20,629,049 probably benign Het
Atr T C 9: 95,862,798 V56A probably benign Het
Aurkc T A 7: 7,002,428 probably null Het
Bnip3 T C 7: 138,898,030 D76G probably damaging Het
Cbr1 A G 16: 93,610,134 E246G possibly damaging Het
Ccdc157 G T 11: 4,146,708 A449D probably damaging Het
Ces3b T A 8: 105,083,851 V26D probably benign Het
Colgalt2 G T 1: 152,508,561 A551S possibly damaging Het
Crk G T 11: 75,703,369 G261C probably damaging Het
Ctbp1 A G 5: 33,250,856 probably null Het
Ctnna1 G A 18: 35,244,122 V572I possibly damaging Het
D430041D05Rik T C 2: 104,201,244 Y1669C probably damaging Het
Dnah8 T C 17: 30,736,156 F2053S probably damaging Het
Dner G A 1: 84,405,965 T566M probably damaging Het
Dner A G 1: 84,445,380 probably benign Het
Edrf1 T C 7: 133,644,022 V223A probably benign Het
Fam169a A G 13: 97,097,715 probably benign Het
Fbxl3 G A 14: 103,095,225 H106Y probably damaging Het
Fiz1 A G 7: 5,009,201 V106A probably benign Het
Gapvd1 T A 2: 34,688,960 R654* probably null Het
Gm7589 G A 9: 59,146,005 noncoding transcript Het
Ifi202b A T 1: 173,977,360 S9T probably benign Het
Ipmk G C 10: 71,372,831 S149T probably benign Het
Irgm2 A G 11: 58,219,519 E24G probably benign Het
Itga2b A C 11: 102,460,846 V551G probably damaging Het
Itgad C T 7: 128,189,978 probably benign Het
Kcnh8 T A 17: 52,725,851 F55L probably damaging Het
Kdr G A 5: 75,950,100 probably benign Het
Krt35 T C 11: 100,095,747 Y147C probably damaging Het
Lamc1 A G 1: 153,255,312 F298L probably benign Het
Lrrk2 T C 15: 91,778,414 probably benign Het
Matn1 T C 4: 130,945,927 S69P probably damaging Het
Micall1 G T 15: 79,131,901 probably benign Het
Msto1 A G 3: 88,911,577 V257A possibly damaging Het
Mybpc3 G C 2: 91,124,024 probably benign Het
Mycn A G 12: 12,937,313 V361A probably benign Het
Myo10 A G 15: 25,793,167 T1277A probably damaging Het
Myo3a T C 2: 22,245,598 I92T probably benign Het
Olfr1199 G A 2: 88,756,456 T73I probably damaging Het
Olfr1510 A G 14: 52,410,263 V203A possibly damaging Het
Olfr267 A G 4: 58,785,344 I126T probably damaging Het
Olfr504 T A 7: 108,565,477 Q106L probably damaging Het
Otog C T 7: 46,277,493 T1222I possibly damaging Het
P4ha1 C T 10: 59,337,148 T23M probably damaging Het
Pld1 A T 3: 28,078,273 I537F probably benign Het
Plekhn1 A G 4: 156,228,323 probably benign Het
Pxdn C A 12: 29,984,440 S8* probably null Het
Rnf135 A T 11: 80,193,958 I186F probably damaging Het
Rock2 T C 12: 16,977,886 probably benign Het
Rph3a C A 5: 120,963,910 G88* probably null Het
Sarm1 G A 11: 78,474,980 Q740* probably null Het
Setd1b C A 5: 123,161,017 probably benign Het
Sidt1 A G 16: 44,281,886 S304P possibly damaging Het
Slc2a4 A T 11: 69,946,355 V85E probably damaging Het
Swi5 A G 2: 32,280,754 Y54H probably damaging Het
Sycp1 A G 3: 102,915,795 probably benign Het
Tarm1 T C 7: 3,497,490 Y87C probably damaging Het
Tmem67 G A 4: 12,087,930 T72M probably damaging Het
Tor1a A G 2: 30,967,725 Y44H possibly damaging Het
Ttll5 T C 12: 85,996,053 Y1128H probably benign Het
Usp40 G A 1: 87,980,958 probably benign Het
Vmn2r18 A T 5: 151,585,203 M152K probably benign Het
Xirp2 T A 2: 67,513,380 D1988E probably damaging Het
Zfp420 A G 7: 29,875,680 I442V probably benign Het
Zyx A G 6: 42,356,005 E363G probably damaging Het
Other mutations in Ano8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ano8 APN 8 71484258 splice site probably benign
IGL00501:Ano8 APN 8 71479149 critical splice donor site probably null
IGL01380:Ano8 APN 8 71480809 unclassified probably benign
IGL02138:Ano8 APN 8 71484842 missense probably damaging 0.99
IGL02516:Ano8 APN 8 71485077 missense probably damaging 1.00
IGL02675:Ano8 APN 8 71483540 missense probably damaging 0.99
IGL02995:Ano8 APN 8 71483117 missense possibly damaging 0.72
H8786:Ano8 UTSW 8 71478744 unclassified probably benign
R0265:Ano8 UTSW 8 71480524 unclassified probably benign
R0518:Ano8 UTSW 8 71479258 missense probably benign 0.39
R0521:Ano8 UTSW 8 71479258 missense probably benign 0.39
R1028:Ano8 UTSW 8 71480971 small deletion probably benign
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1147:Ano8 UTSW 8 71482017 missense probably damaging 1.00
R1748:Ano8 UTSW 8 71478958 unclassified probably benign
R1852:Ano8 UTSW 8 71483487 missense probably damaging 0.99
R4161:Ano8 UTSW 8 71482637 missense probably damaging 1.00
R4192:Ano8 UTSW 8 71483292 missense probably damaging 1.00
R4274:Ano8 UTSW 8 71478741 unclassified probably benign
R4834:Ano8 UTSW 8 71484295 missense probably damaging 1.00
R4961:Ano8 UTSW 8 71482996 missense probably damaging 1.00
R5252:Ano8 UTSW 8 71482617 missense probably damaging 1.00
R5553:Ano8 UTSW 8 71484997 splice site probably null
R5598:Ano8 UTSW 8 71482577 missense probably damaging 1.00
R5695:Ano8 UTSW 8 71483243 missense probably damaging 0.98
R5994:Ano8 UTSW 8 71484834 missense probably damaging 1.00
R6019:Ano8 UTSW 8 71482380 missense probably damaging 1.00
R6153:Ano8 UTSW 8 71480797 unclassified probably benign
R6405:Ano8 UTSW 8 71483030 missense probably damaging 1.00
R6516:Ano8 UTSW 8 71481780 unclassified probably null
R6539:Ano8 UTSW 8 71484483 missense probably damaging 1.00
R7194:Ano8 UTSW 8 71482363 missense possibly damaging 0.66
R7204:Ano8 UTSW 8 71479025 missense probably benign 0.39
R7340:Ano8 UTSW 8 71483011 missense probably damaging 0.99
R7365:Ano8 UTSW 8 71485110 missense probably damaging 1.00
R7417:Ano8 UTSW 8 71480833 missense unknown
R7486:Ano8 UTSW 8 71484998 critical splice donor site probably null
R7644:Ano8 UTSW 8 71484830 missense probably damaging 0.98
R7709:Ano8 UTSW 8 71482289 missense probably damaging 1.00
R7719:Ano8 UTSW 8 71483140 missense possibly damaging 0.82
R8040:Ano8 UTSW 8 71482168 missense probably benign 0.26
R8219:Ano8 UTSW 8 71480713 missense unknown
X0026:Ano8 UTSW 8 71479157 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGCTCTCTAGCTCTGCCTGCGTGAG -3'
(R):5'- CGAGGAAGGAAGCCTCCTAGACTGC -3'

Sequencing Primer
(F):5'- TCCACGAGGACCTGTTATGTCT -3'
(R):5'- CTCAAGAAGGTCAGCTTTGC -3'
Posted On2013-05-23