Incidental Mutation 'R4867:Rhog'
ID376235
Institutional Source Beutler Lab
Gene Symbol Rhog
Ensembl Gene ENSMUSG00000073982
Gene Nameras homolog family member G
SynonymsRhoG, Sid10750, Arhg, 2810426G09Rik
MMRRC Submission 042477-MU
Accession Numbers
Is this an essential gene? Not available question?
Stock #R4867 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location102239123-102256054 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 102240150 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Serine at position 32 (Y32S)
Ref Sequence ENSEMBL: ENSMUSP00000147985 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033292] [ENSMUST00000098230] [ENSMUST00000106923] [ENSMUST00000119816] [ENSMUST00000120119] [ENSMUST00000120879] [ENSMUST00000126914] [ENSMUST00000129340] [ENSMUST00000138479] [ENSMUST00000138753] [ENSMUST00000140058] [ENSMUST00000142873] [ENSMUST00000143541] [ENSMUST00000145352] [ENSMUST00000153020] [ENSMUST00000156529] [ENSMUST00000209968]
Predicted Effect probably benign
Transcript: ENSMUST00000033292
SMART Domains Protein: ENSMUSP00000033292
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 241 2e-51 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000098230
AA Change: Y32S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000095832
Gene: ENSMUSG00000073982
AA Change: Y32S

DomainStartEndE-ValueType
RHO 6 179 1.87e-133 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106923
AA Change: Y32S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102536
Gene: ENSMUSG00000073982
AA Change: Y32S

DomainStartEndE-ValueType
RHO 6 179 1.87e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119816
SMART Domains Protein: ENSMUSP00000113261
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120119
SMART Domains Protein: ENSMUSP00000113574
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 16 239 1.6e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120879
SMART Domains Protein: ENSMUSP00000114016
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 237 7.2e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000126914
SMART Domains Protein: ENSMUSP00000114853
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 101 6.6e-17 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127804
Predicted Effect probably benign
Transcript: ENSMUST00000129340
SMART Domains Protein: ENSMUSP00000119692
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134621
Predicted Effect probably benign
Transcript: ENSMUST00000138479
SMART Domains Protein: ENSMUSP00000115590
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 209 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000138753
SMART Domains Protein: ENSMUSP00000116858
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 123 9.1e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140058
SMART Domains Protein: ENSMUSP00000122482
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142873
SMART Domains Protein: ENSMUSP00000121988
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 136 3.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143541
SMART Domains Protein: ENSMUSP00000117450
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 79 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143759
Predicted Effect probably benign
Transcript: ENSMUST00000145352
SMART Domains Protein: ENSMUSP00000123523
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150891
Predicted Effect probably benign
Transcript: ENSMUST00000153020
SMART Domains Protein: ENSMUSP00000123570
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 209 5.9e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156529
SMART Domains Protein: ENSMUSP00000121521
Gene: ENSMUSG00000030990

DomainStartEndE-ValueType
Pfam:Frag1 18 237 7.2e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000209968
AA Change: Y32S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214560
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho family of small GTPases, which cycle between inactive GDP-bound and active GTP-bound states and function as molecular switches in signal transduction cascades. Rho proteins promote reorganization of the actin cytoskeleton and regulate cell shape, attachment, and motility. The encoded protein facilitates translocation of a functional guanine nucleotide exchange factor (GEF) complex from the cytoplasm to the plasma membrane where ras-related C3 botulinum toxin substrate 1 is activated to promote lamellipodium formation and cell migration. Two related pseudogene have been identified on chromosomes 20 and X. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for disruptions in this gene display and essentially normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,639,360 I215V probably damaging Het
4921509C19Rik A T 2: 151,472,822 L312* probably null Het
9930111J21Rik1 T A 11: 48,948,548 probably null Het
Abca6 C A 11: 110,202,379 V1023F probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acsbg2 A G 17: 56,862,914 I151T possibly damaging Het
Arhgap8 G T 15: 84,740,766 L46F probably benign Het
Arid1a G A 4: 133,720,857 S115L probably benign Het
B4galnt2 T C 11: 95,868,426 D344G probably damaging Het
BC005561 T C 5: 104,521,002 I1130T possibly damaging Het
Ccdc40 T C 11: 119,231,788 S139P probably benign Het
Ccnjl T C 11: 43,583,228 V210A possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cog4 T C 8: 110,866,610 V451A probably damaging Het
Crb1 A T 1: 139,243,014 N818K probably damaging Het
Crtc1 T C 8: 70,402,514 D152G probably damaging Het
Cse1l T A 2: 166,926,403 I207N possibly damaging Het
Cux1 TGGCAGGCGCG TG 5: 136,274,961 probably benign Het
Cyp2j13 T C 4: 96,058,998 Y272C possibly damaging Het
Cyp4f16 T C 17: 32,550,750 F445L possibly damaging Het
Dlc1 T C 8: 36,584,645 H644R probably benign Het
Ecm2 A T 13: 49,531,345 I643F probably damaging Het
Eogt A T 6: 97,120,147 probably benign Het
Fbxo41 A C 6: 85,475,194 S777A probably benign Het
Fga T A 3: 83,028,644 D59E probably benign Het
Flt3 A T 5: 147,334,440 V897D probably damaging Het
Fmn1 G T 2: 113,584,120 probably null Het
Frem3 T C 8: 80,613,283 L735P probably damaging Het
Ftmt A T 18: 52,332,053 D147V possibly damaging Het
Gabpa T A 16: 84,857,468 D344E probably benign Het
Gm4788 A T 1: 139,774,475 probably null Het
Gtf3a C T 5: 146,951,913 Q145* probably null Het
Il1f5 A T 2: 24,280,835 N48I probably damaging Het
Iqca A G 1: 90,089,504 L403S probably benign Het
Jrk C T 15: 74,707,220 R72Q probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Krt12 T C 11: 99,416,963 D433G possibly damaging Het
Lce1h A T 3: 92,763,463 S127R unknown Het
Lrrc7 T G 3: 158,161,005 Y1033S probably damaging Het
Macf1 A G 4: 123,472,200 S1358P probably damaging Het
Mfsd1 T A 3: 67,587,987 probably null Het
Mki67 T C 7: 135,699,856 T1150A probably damaging Het
Nadk2 A G 15: 9,098,857 I291M possibly damaging Het
Olfr309 T C 7: 86,306,283 T277A probably benign Het
Olfr340 A C 2: 36,453,199 M205L probably benign Het
Olfr456 A G 6: 42,487,097 V32A probably benign Het
Olfr49 T A 14: 54,282,629 T89S probably benign Het
Olfr829 A T 9: 18,857,566 I305F probably benign Het
Parp14 T A 16: 35,857,327 Y757F probably benign Het
Pcdh18 T C 3: 49,754,664 Y734C probably damaging Het
Pcnx4 T C 12: 72,573,952 S849P probably benign Het
Pds5a T C 5: 65,644,120 K595E probably damaging Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Ptgdr G T 14: 44,858,796 P153Q probably damaging Het
Rbm12b2 T C 4: 12,094,805 S555P probably damaging Het
Rnf141 T C 7: 110,816,768 T209A probably damaging Het
Rtkn2 T C 10: 68,001,927 I103T probably damaging Het
Scn5a G T 9: 119,550,671 C182* probably null Het
Sema3a A G 5: 13,451,241 N84D probably benign Het
Sema5a G T 15: 32,550,290 M158I possibly damaging Het
Shprh T A 10: 11,164,557 D71E probably benign Het
Slc26a8 A G 17: 28,663,634 I239T probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Ston1 C T 17: 88,635,694 A176V probably damaging Het
Sult2a5 T C 7: 13,624,051 S3P probably benign Het
Tango6 T A 8: 106,818,526 V1007E probably damaging Het
Tank G A 2: 61,578,635 probably benign Het
Tas2r124 A G 6: 132,755,193 Y155C probably damaging Het
Tenm3 G A 8: 48,235,821 R2244W probably damaging Het
Tlk1 A T 2: 70,721,571 Y585* probably null Het
Tmem221 C T 8: 71,555,140 E214K probably benign Het
Tmem38a T C 8: 72,581,233 V172A possibly damaging Het
Tspo2 C T 17: 48,448,677 A146T possibly damaging Het
Ttc3 G A 16: 94,454,515 A1268T probably damaging Het
Usp25 T A 16: 77,050,467 D154E probably damaging Het
Usp34 T C 11: 23,451,999 F2410L probably benign Het
Vmn1r128 T A 7: 21,350,014 H214Q possibly damaging Het
Vmn1r24 A C 6: 57,956,436 C32W probably damaging Het
Zfp931 T A 2: 178,068,062 H177L probably damaging Het
Znrf1 T C 8: 111,537,566 probably null Het
Other mutations in Rhog
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1224:Rhog UTSW 7 102239752 missense possibly damaging 0.78
R3004:Rhog UTSW 7 102240138 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGTTCTCATAGGAGGGTGGAC -3'
(R):5'- TCTTCTCAGTAGGTACAGGTCTCC -3'

Sequencing Primer
(F):5'- CTGGCAATGGAGAAACAGATGAC -3'
(R):5'- CTCAGTAGGTACAGGTCTCCTAAATC -3'
Posted On2016-03-17