Incidental Mutation 'R4867:Shprh'
ID376249
Institutional Source Beutler Lab
Gene Symbol Shprh
Ensembl Gene ENSMUSG00000090112
Gene NameSNF2 histone linker PHD RING helicase
Synonyms2610103K11Rik, D230017O13Rik
MMRRC Submission 042477-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4867 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location11149427-11217595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11164557 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 71 (D71E)
Ref Sequence ENSEMBL: ENSMUSP00000125127 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044053] [ENSMUST00000054814] [ENSMUST00000159541] [ENSMUST00000159810] [ENSMUST00000160461]
Predicted Effect probably benign
Transcript: ENSMUST00000044053
AA Change: D591E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000039422
Gene: ENSMUSG00000090112
AA Change: D591E

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
Pfam:Helicase_C 1500 1613 1.6e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000054814
AA Change: D591E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125849
Gene: ENSMUSG00000090112
AA Change: D591E

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1616 6e-8 SMART
Blast:HELICc 1533 1613 4e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000159541
AA Change: D591E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132870
Gene: ENSMUSG00000090112
AA Change: D591E

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 3e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
low complexity region 1393 1404 N/A INTRINSIC
RING 1423 1469 9.68e-3 SMART
SCOP:d1fuka_ 1504 1619 4e-8 SMART
Blast:HELICc 1533 1613 6e-46 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159553
Predicted Effect probably benign
Transcript: ENSMUST00000159810
AA Change: D591E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000125457
Gene: ENSMUSG00000090112
AA Change: D591E

DomainStartEndE-ValueType
low complexity region 42 56 N/A INTRINSIC
Blast:DEXDc 195 250 2e-12 BLAST
low complexity region 253 265 N/A INTRINSIC
DEXDc 295 866 4.02e-17 SMART
H15 431 497 3.76e-5 SMART
PHD 651 698 2.33e-5 SMART
Blast:DEXDc 948 1026 2e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000160461
AA Change: D71E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000125127
Gene: ENSMUSG00000090112
AA Change: D71E

DomainStartEndE-ValueType
PHD 131 178 2.33e-5 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SHPRH is a ubiquitously expressed protein that contains motifs characteristics of several DNA repair proteins, transcription factors, and helicases. SHPRH is a functional homolog of S. cerevisiae RAD5 (Unk et al., 2006 [PubMed 17108083]).[supplied by OMIM, Mar 2008]
PHENOTYPE: The gene product is an E3 ligase involved in poly-ubiquitination of Pcna. Neither homozygous truncation nor KO affect B cell somatic hypermutation or class switching. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 80 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik T C 8: 124,639,360 I215V probably damaging Het
4921509C19Rik A T 2: 151,472,822 L312* probably null Het
9930111J21Rik1 T A 11: 48,948,548 probably null Het
Abca6 C A 11: 110,202,379 V1023F probably benign Het
Ablim2 C T 5: 35,802,422 R73C possibly damaging Het
Acsbg2 A G 17: 56,862,914 I151T possibly damaging Het
Arhgap8 G T 15: 84,740,766 L46F probably benign Het
Arid1a G A 4: 133,720,857 S115L probably benign Het
B4galnt2 T C 11: 95,868,426 D344G probably damaging Het
BC005561 T C 5: 104,521,002 I1130T possibly damaging Het
Ccdc40 T C 11: 119,231,788 S139P probably benign Het
Ccnjl T C 11: 43,583,228 V210A possibly damaging Het
Cdk5rap1 C T 2: 154,370,956 probably null Het
Cog4 T C 8: 110,866,610 V451A probably damaging Het
Crb1 A T 1: 139,243,014 N818K probably damaging Het
Crtc1 T C 8: 70,402,514 D152G probably damaging Het
Cse1l T A 2: 166,926,403 I207N possibly damaging Het
Cux1 TGGCAGGCGCG TG 5: 136,274,961 probably benign Het
Cyp2j13 T C 4: 96,058,998 Y272C possibly damaging Het
Cyp4f16 T C 17: 32,550,750 F445L possibly damaging Het
Dlc1 T C 8: 36,584,645 H644R probably benign Het
Ecm2 A T 13: 49,531,345 I643F probably damaging Het
Eogt A T 6: 97,120,147 probably benign Het
Fbxo41 A C 6: 85,475,194 S777A probably benign Het
Fga T A 3: 83,028,644 D59E probably benign Het
Flt3 A T 5: 147,334,440 V897D probably damaging Het
Fmn1 G T 2: 113,584,120 probably null Het
Frem3 T C 8: 80,613,283 L735P probably damaging Het
Ftmt A T 18: 52,332,053 D147V possibly damaging Het
Gabpa T A 16: 84,857,468 D344E probably benign Het
Gm4788 A T 1: 139,774,475 probably null Het
Gtf3a C T 5: 146,951,913 Q145* probably null Het
Il1f5 A T 2: 24,280,835 N48I probably damaging Het
Iqca A G 1: 90,089,504 L403S probably benign Het
Jrk C T 15: 74,707,220 R72Q probably benign Het
Kif19a G A 11: 114,767,227 M37I probably benign Het
Krt12 T C 11: 99,416,963 D433G possibly damaging Het
Lce1h A T 3: 92,763,463 S127R unknown Het
Lrrc7 T G 3: 158,161,005 Y1033S probably damaging Het
Macf1 A G 4: 123,472,200 S1358P probably damaging Het
Mfsd1 T A 3: 67,587,987 probably null Het
Mki67 T C 7: 135,699,856 T1150A probably damaging Het
Nadk2 A G 15: 9,098,857 I291M possibly damaging Het
Olfr309 T C 7: 86,306,283 T277A probably benign Het
Olfr340 A C 2: 36,453,199 M205L probably benign Het
Olfr456 A G 6: 42,487,097 V32A probably benign Het
Olfr49 T A 14: 54,282,629 T89S probably benign Het
Olfr829 A T 9: 18,857,566 I305F probably benign Het
Parp14 T A 16: 35,857,327 Y757F probably benign Het
Pcdh18 T C 3: 49,754,664 Y734C probably damaging Het
Pcnx4 T C 12: 72,573,952 S849P probably benign Het
Pds5a T C 5: 65,644,120 K595E probably damaging Het
Prkg2 T A 5: 99,024,709 Y49F probably benign Het
Ptgdr G T 14: 44,858,796 P153Q probably damaging Het
Rbm12b2 T C 4: 12,094,805 S555P probably damaging Het
Rhog T G 7: 102,240,150 Y32S probably damaging Het
Rnf141 T C 7: 110,816,768 T209A probably damaging Het
Rtkn2 T C 10: 68,001,927 I103T probably damaging Het
Scn5a G T 9: 119,550,671 C182* probably null Het
Sema3a A G 5: 13,451,241 N84D probably benign Het
Sema5a G T 15: 32,550,290 M158I possibly damaging Het
Slc26a8 A G 17: 28,663,634 I239T probably benign Het
Slco4c1 G A 1: 96,841,228 P303L probably damaging Het
Ston1 C T 17: 88,635,694 A176V probably damaging Het
Sult2a5 T C 7: 13,624,051 S3P probably benign Het
Tango6 T A 8: 106,818,526 V1007E probably damaging Het
Tank G A 2: 61,578,635 probably benign Het
Tas2r124 A G 6: 132,755,193 Y155C probably damaging Het
Tenm3 G A 8: 48,235,821 R2244W probably damaging Het
Tlk1 A T 2: 70,721,571 Y585* probably null Het
Tmem221 C T 8: 71,555,140 E214K probably benign Het
Tmem38a T C 8: 72,581,233 V172A possibly damaging Het
Tspo2 C T 17: 48,448,677 A146T possibly damaging Het
Ttc3 G A 16: 94,454,515 A1268T probably damaging Het
Usp25 T A 16: 77,050,467 D154E probably damaging Het
Usp34 T C 11: 23,451,999 F2410L probably benign Het
Vmn1r128 T A 7: 21,350,014 H214Q possibly damaging Het
Vmn1r24 A C 6: 57,956,436 C32W probably damaging Het
Zfp931 T A 2: 178,068,062 H177L probably damaging Het
Znrf1 T C 8: 111,537,566 probably null Het
Other mutations in Shprh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00492:Shprh APN 10 11188158 missense probably damaging 1.00
IGL00583:Shprh APN 10 11188020 missense probably benign 0.37
IGL00684:Shprh APN 10 11163037 missense probably benign 0.11
IGL01295:Shprh APN 10 11183868 missense probably damaging 0.96
IGL01387:Shprh APN 10 11170254 missense probably damaging 1.00
IGL01635:Shprh APN 10 11170019 nonsense probably null
IGL01833:Shprh APN 10 11191062 missense probably damaging 1.00
IGL02013:Shprh APN 10 11181502 splice site probably benign
IGL02502:Shprh APN 10 11194357 missense possibly damaging 0.66
IGL02819:Shprh APN 10 11154765 missense possibly damaging 0.93
PIT4581001:Shprh UTSW 10 11192494 frame shift probably null
R0010:Shprh UTSW 10 11151931 missense probably benign
R0010:Shprh UTSW 10 11151931 missense probably benign
R0053:Shprh UTSW 10 11194372 splice site probably null
R0053:Shprh UTSW 10 11194372 splice site probably null
R0255:Shprh UTSW 10 11186391 missense possibly damaging 0.92
R0325:Shprh UTSW 10 11170109 missense probably benign 0.00
R0331:Shprh UTSW 10 11194170 splice site probably benign
R0494:Shprh UTSW 10 11157191 missense probably damaging 1.00
R0532:Shprh UTSW 10 11162812 missense possibly damaging 0.90
R0546:Shprh UTSW 10 11183887 splice site probably benign
R0574:Shprh UTSW 10 11163077 unclassified probably benign
R0605:Shprh UTSW 10 11207112 missense probably damaging 1.00
R0662:Shprh UTSW 10 11186847 missense probably damaging 1.00
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1148:Shprh UTSW 10 11213482 missense possibly damaging 0.95
R1263:Shprh UTSW 10 11159530 missense probably damaging 1.00
R1588:Shprh UTSW 10 11164744 missense probably damaging 1.00
R1638:Shprh UTSW 10 11157078 missense probably benign
R1830:Shprh UTSW 10 11186911 splice site probably null
R1898:Shprh UTSW 10 11186869 missense probably damaging 1.00
R1903:Shprh UTSW 10 11183797 nonsense probably null
R2060:Shprh UTSW 10 11152120 missense probably benign 0.03
R2225:Shprh UTSW 10 11162235 unclassified probably benign
R2363:Shprh UTSW 10 11171953 missense probably damaging 1.00
R2509:Shprh UTSW 10 11166724 missense probably damaging 1.00
R2891:Shprh UTSW 10 11164356 missense probably damaging 1.00
R3077:Shprh UTSW 10 11170413 missense probably damaging 1.00
R3150:Shprh UTSW 10 11170030 missense probably damaging 0.97
R3796:Shprh UTSW 10 11178757 missense possibly damaging 0.89
R4196:Shprh UTSW 10 11207860 utr 3 prime probably benign
R4423:Shprh UTSW 10 11186518 missense possibly damaging 0.82
R4488:Shprh UTSW 10 11160471 missense probably benign 0.17
R4748:Shprh UTSW 10 11170476 missense probably damaging 1.00
R4768:Shprh UTSW 10 11181540 missense probably damaging 0.96
R4937:Shprh UTSW 10 11157119 missense probably benign
R5140:Shprh UTSW 10 11154705 missense probably benign 0.03
R5318:Shprh UTSW 10 11166557 missense probably benign 0.04
R5323:Shprh UTSW 10 11170297 splice site probably null
R5450:Shprh UTSW 10 11212330 missense possibly damaging 0.70
R5872:Shprh UTSW 10 11188073 missense probably damaging 1.00
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6030:Shprh UTSW 10 11151991 missense probably benign 0.37
R6392:Shprh UTSW 10 11178741 nonsense probably null
R6416:Shprh UTSW 10 11167873 missense probably damaging 1.00
R6470:Shprh UTSW 10 11171937 missense probably damaging 0.98
R6513:Shprh UTSW 10 11186893 missense probably damaging 1.00
R6530:Shprh UTSW 10 11194267 missense probably benign 0.02
R6678:Shprh UTSW 10 11166545 missense probably benign 0.16
R6757:Shprh UTSW 10 11181508 splice site probably null
R6971:Shprh UTSW 10 11166693 missense probably damaging 1.00
R7158:Shprh UTSW 10 11166730 missense probably damaging 0.98
R7582:Shprh UTSW 10 11164705 missense probably benign
R7757:Shprh UTSW 10 11162180 missense probably benign 0.30
R7812:Shprh UTSW 10 11151991 missense probably benign
R7998:Shprh UTSW 10 11185341 missense probably damaging 1.00
R8061:Shprh UTSW 10 11212333 missense possibly damaging 0.71
R8082:Shprh UTSW 10 11151811 missense probably benign 0.22
R8116:Shprh UTSW 10 11213461 missense probably damaging 0.99
R8390:Shprh UTSW 10 11187983 missense possibly damaging 0.92
R8445:Shprh UTSW 10 11181569 missense possibly damaging 0.92
R8530:Shprh UTSW 10 11151934 missense probably benign 0.37
R8759:Shprh UTSW 10 11157164 missense possibly damaging 0.92
R8937:Shprh UTSW 10 11185437 missense possibly damaging 0.60
RF012:Shprh UTSW 10 11164841 missense probably benign 0.02
V8831:Shprh UTSW 10 11186862 missense probably damaging 1.00
Z1176:Shprh UTSW 10 11164553 missense probably benign
Z1176:Shprh UTSW 10 11186447 missense probably damaging 1.00
Z1177:Shprh UTSW 10 11151762 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCATAGGCAGTAGGGAGTCC -3'
(R):5'- ACACTCAAAGCGGTAATCAGAG -3'

Sequencing Primer
(F):5'- CAGTAGGGAGTCCAAGGAAAATTG -3'
(R):5'- CACTCAAAGCGGTAATCAGAGGTTTC -3'
Posted On2016-03-17