Incidental Mutation 'R4868:Fpgs'
ID376291
Institutional Source Beutler Lab
Gene Symbol Fpgs
Ensembl Gene ENSMUSG00000009566
Gene Namefolylpolyglutamyl synthetase
Synonyms
MMRRC Submission 042478-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R4868 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location32682609-32704145 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 32692661 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 63 (R63C)
Ref Sequence ENSEMBL: ENSMUSP00000141899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028148] [ENSMUST00000127812] [ENSMUST00000143743] [ENSMUST00000146498]
Predicted Effect probably damaging
Transcript: ENSMUST00000028148
AA Change: R67C

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000028148
Gene: ENSMUSG00000009566
AA Change: R67C

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
SCOP:d1jbwa2 43 327 1e-59 SMART
PDB:1O5Z|A 99 389 2e-37 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000127812
AA Change: R63C

PolyPhen 2 Score 0.896 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000116434
Gene: ENSMUSG00000009566
AA Change: R63C

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 243 3e-48 SMART
PDB:1O5Z|A 56 243 4e-30 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130164
Predicted Effect probably benign
Transcript: ENSMUST00000143743
Predicted Effect probably damaging
Transcript: ENSMUST00000146498
AA Change: R63C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141899
Gene: ENSMUSG00000009566
AA Change: R63C

DomainStartEndE-ValueType
SCOP:d1jbwa2 40 126 2e-14 SMART
low complexity region 136 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149491
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185043
Meta Mutation Damage Score 0.4826 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 99% (91/92)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the folylpolyglutamate synthetase enzyme. This enzyme has a central role in establishing and maintaining both cytosolic and mitochondrial folylpolyglutamate concentrations and, therefore, is essential for folate homeostasis and the survival of proliferating cells. This enzyme catalyzes the ATP-dependent addition of glutamate moieties to folate and folate derivatives. Alternative splicing results in transcript variants encoding different isoforms. [provided by RefSeq, Jan 2014]
Allele List at MGI
Other mutations in this stock
Total: 87 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933405L10Rik A G 8: 105,710,097 *299W probably null Het
4933412E24Rik G A 15: 60,015,968 L208F possibly damaging Het
Abca8b G A 11: 109,974,512 A373V probably benign Het
Actn3 A T 19: 4,864,454 W549R probably benign Het
Adamts4 C T 1: 171,252,431 probably benign Het
Adcy4 T C 14: 55,773,722 I615V probably benign Het
Akap1 A G 11: 88,844,553 S428P possibly damaging Het
Akap13 A T 7: 75,743,504 R2476W probably damaging Het
Alx3 A G 3: 107,600,627 S151G possibly damaging Het
Aoah T A 13: 20,914,981 Y243* probably null Het
Asap1 A G 15: 64,094,181 V1025A probably benign Het
Atp8b1 A T 18: 64,551,866 I728N probably damaging Het
Baz2b C A 2: 59,924,882 V1001L possibly damaging Het
Bmpr2 T A 1: 59,870,456 S1030T probably benign Het
Cacna2d3 A T 14: 28,956,786 probably null Het
Casp3 A T 8: 46,634,279 N87I probably benign Het
Ccdc171 T A 4: 83,694,332 L995Q probably damaging Het
Ccdc80 T A 16: 45,104,413 Y637N probably damaging Het
Ccr4 A G 9: 114,492,833 F55L probably benign Het
Cmah T A 13: 24,464,264 V494E probably damaging Het
Cnot6l A G 5: 96,083,023 Y362H probably damaging Het
Coq6 T C 12: 84,370,952 V222A probably damaging Het
Ctdspl2 C A 2: 121,993,398 T240N possibly damaging Het
D430041D05Rik T C 2: 104,255,409 T248A possibly damaging Het
Dctn6 A T 8: 34,092,076 probably benign Het
Dhx34 T C 7: 16,199,802 D955G probably benign Het
Dnaaf5 A G 5: 139,170,186 M541V probably benign Het
Dnah17 A T 11: 118,108,212 S912T probably benign Het
Dnah2 A T 11: 69,463,648 V2248E probably damaging Het
Dysf T C 6: 84,179,693 W1502R probably damaging Het
Dzip1 A T 14: 118,877,214 V843E probably damaging Het
Esp23 G T 17: 39,074,024 T27K probably benign Het
Esp3 A T 17: 40,633,529 M21L possibly damaging Het
Fam43b T A 4: 138,395,797 T71S probably benign Het
Fam46b A G 4: 133,486,082 probably null Het
H2-M11 G T 17: 36,548,919 W268L probably damaging Het
Inpp5b T C 4: 124,751,410 S210P probably damaging Het
Itsn1 T A 16: 91,785,317 S51T probably damaging Het
Kctd2 G A 11: 115,429,379 V246I probably damaging Het
Krt75 C T 15: 101,568,121 G403E probably damaging Het
Lamp3 T A 16: 19,701,290 T48S probably benign Het
Lyzl4 C A 9: 121,583,009 V114L probably damaging Het
Maml3 C A 3: 52,103,924 E74* probably null Het
Map2k7 G A 8: 4,247,751 probably benign Het
Mapk8ip3 A G 17: 24,901,415 V883A probably benign Het
Mbtps1 C T 8: 119,508,928 V1004I probably benign Het
Metap1 G T 3: 138,483,089 H48Q probably damaging Het
Mical2 T A 7: 112,318,624 V396E probably damaging Het
Mks1 T A 11: 87,853,723 probably benign Het
Ndst1 T C 18: 60,695,476 T669A probably benign Het
Obox3 T C 7: 15,627,310 K10R probably damaging Het
Olfr1014 T G 2: 85,776,626 V14G possibly damaging Het
Olfr1318 T A 2: 112,156,571 S207T probably damaging Het
Olfr711 C T 7: 106,971,767 M192I probably benign Het
Opn3 T C 1: 175,663,561 Y302C probably damaging Het
Pdzph1 A T 17: 58,974,756 V177D probably benign Het
Pex5l T A 3: 32,952,490 I577F probably damaging Het
Pmpcb T A 5: 21,748,853 Y366* probably null Het
Prr14l A T 5: 32,829,937 M738K probably benign Het
Prx T C 7: 27,517,579 S641P probably benign Het
Ptchd3 A G 11: 121,831,057 Y252C possibly damaging Het
Reg3a A G 6: 78,381,900 E27G probably damaging Het
Ripor2 A G 13: 24,694,141 T300A possibly damaging Het
Sdf4 T A 4: 156,009,185 S259T probably damaging Het
Sike1 A G 3: 102,997,414 probably null Het
Sis T G 3: 72,943,548 I606L probably benign Het
Slc30a9 T C 5: 67,324,683 I94T probably benign Het
Slc5a4a T C 10: 76,178,231 I424T probably damaging Het
Spx C T 6: 142,416,390 R72* probably null Het
St7 C A 6: 17,819,266 N56K probably damaging Het
Tcte2 C A 17: 13,728,008 G3V probably damaging Het
Tgfb3 T C 12: 86,062,181 D258G probably benign Het
Timeless G T 10: 128,247,361 G659V probably benign Het
Tnn T C 1: 160,130,873 R467G possibly damaging Het
Tor1b T C 2: 30,956,577 probably null Het
Trank1 T A 9: 111,365,641 L911Q probably damaging Het
Ttll2 C T 17: 7,351,599 V310I probably benign Het
Ttyh3 A T 5: 140,629,466 I389N probably damaging Het
Ube3b T C 5: 114,398,427 V216A probably benign Het
Vezf1 T A 11: 88,074,694 V254E probably damaging Het
Vmn1r122 T C 7: 21,133,302 E276G probably benign Het
Vmn1r167 T A 7: 23,504,736 N285I probably benign Het
Vmn2r45 T A 7: 8,481,481 I442F probably benign Het
Vwa8 C A 14: 79,183,082 A1741E probably damaging Het
Wdr20 T A 12: 110,738,234 V69E probably damaging Het
Xkr4 T G 1: 3,216,851 Q372P probably damaging Het
Zcchc11 T C 4: 108,549,220 probably benign Het
Other mutations in Fpgs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Fpgs APN 2 32686547 unclassified probably benign
IGL00493:Fpgs APN 2 32687997 missense possibly damaging 0.49
IGL02397:Fpgs APN 2 32685789 missense probably damaging 1.00
IGL02867:Fpgs APN 2 32685879 unclassified probably benign
IGL02889:Fpgs APN 2 32685879 unclassified probably benign
IGL03082:Fpgs APN 2 32685757 nonsense probably null
IGL03126:Fpgs APN 2 32683123 missense possibly damaging 0.86
R0243:Fpgs UTSW 2 32692494 nonsense probably null
R0312:Fpgs UTSW 2 32684801 missense probably damaging 0.99
R1326:Fpgs UTSW 2 32692580 unclassified probably null
R1558:Fpgs UTSW 2 32685840 missense possibly damaging 0.77
R1624:Fpgs UTSW 2 32691188 critical splice donor site probably null
R1934:Fpgs UTSW 2 32687981 missense probably damaging 1.00
R3706:Fpgs UTSW 2 32687996 missense probably damaging 1.00
R4439:Fpgs UTSW 2 32687501 missense probably damaging 1.00
R4440:Fpgs UTSW 2 32687501 missense probably damaging 1.00
R4979:Fpgs UTSW 2 32687367 unclassified probably benign
R5279:Fpgs UTSW 2 32692767 intron probably benign
R6337:Fpgs UTSW 2 32687941 nonsense probably null
R6648:Fpgs UTSW 2 32684787 nonsense probably null
R6668:Fpgs UTSW 2 32687606 missense probably benign 0.05
R6768:Fpgs UTSW 2 32686623 missense probably benign 0.01
R7134:Fpgs UTSW 2 32686629 missense probably benign 0.25
R7360:Fpgs UTSW 2 32693993 missense possibly damaging 0.91
R7868:Fpgs UTSW 2 32683460 missense probably damaging 1.00
R7951:Fpgs UTSW 2 32683460 missense probably damaging 1.00
Z1176:Fpgs UTSW 2 32692660 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TTAGCCGGTTCAAGTCCTCC -3'
(R):5'- TGGCTCCCATCTTTGCTAGAAC -3'

Sequencing Primer
(F):5'- GGTTCAAGTCCTCCACCTACAACAG -3'
(R):5'- CTTTGCTAGAACTGGAGATATGCC -3'
Posted On2016-03-17